Phone (USA) +1 212-348-5610
Whatsapp: +1 516-336-9307
WeChat: chembuyersguide
Chemical Search
 
























Conier Chem&Pharma Limited.




Country: China

11F,#5 Building,
Asia pacific enterprise valley,
Nanping,Nan'an,
Chongqing, China.


Phone: +86-23-62922305
Phone 2: +86-139 9626 9627
FAX: +86-23-62457927
E-Mail:E-Mail this Supplier


http://www.conier.com

Conier Chem&Pharma Limited.

Page: Home | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 | 34 | 35 | 36 | 37 | 38 | 39 | 40 | 41 | 42 | 43 | 44 | 45 | 46 | 47 | 48 | 49 | 50 | 51 | 52 | 53 | 54 | 55 | 56 | 57 | 58 | 59 | 60 | 61 | 62 | 63 | 64 | 65 | 66 | 67 | 68 | 69 | 70 | 71 | 72 | 73 | 74 | 75 | 76 | 77 | 78 | 79 | 80 | 81 | 82 | 83 | 84 | 85 | 86 | 87 | 88 | 89 | 90 | 91 | 92 | 93 | 94 | 95 | 96 | 97 | 98 | 99 | 100 | 101 | 102 | 103 | 104 | 105 | 106 | 107 | 108 | 109 | 110 | 111 | 112 | 113 | 114 | 115 | 116 | 117 | 118 | 119 | 120 | 121 | 122 | 123 | 124 | 125 | 126 | 127 | 128 | 129 | 130 | 131 | 132 | 133 | 134 | 135 | 136 | 137 | 138 | 139 | 140 | 141 | 142 | 143 | 144 | 145 | 146 | 147 | 148 | 149 | 150 | 151 | 152 | 153 | 154 | 155 | 156 | 157 | 158 | 159 | 160 | 161 | 162 | 163 | 164 | 165 | 166 | 167 | 168 | 169 | 170 | 171 | 172 | 173 | 174 | 175 | 176 | 177 | 178 | 179 | 180 | 181 | 182 | 183 | 184 | 185 | 186 | 187 | 188 | 189 | 190 | 191 | 192 | 193 | 194 | 195 | 196 | 197 | 198 | 199 | 200 | 201 | 202 | 203 | 204 | 205 | 206 | 207 | 208 | 209 | 210 | 211 | 212 | 213 | 214 | 215 | 216 | 217 | 218 | 219 | 220 | 221 | 222 | 223 | 224 | 225 | 226 | 227 | 228 | 229 | 230 | 231 | 232 | 233 | 234 | 235 | 236 | 237 | 238 | 239 | 240 | 241 | 242 | 243 | 244 | 245 | 246 | 247 | 248 | 249 | 250 | 251 | 252 | 253 | 254 | 255 | 256 | 257 | 258 | 259 | 260 | 261 | 262 | 263 | 264 | 265 | 266 | 267 | 268 | 269 | 270 | 271 | 272 | 273 | 274 | 275 | 276 | 277 | 278 | 279 | 280 | 281 | 282 | 283 | 284 | 285 | 286 | 287 | 288 | 289 | 290 | 291 | 292 | 293 | 294 | 295 | 296 | 297 | 298 | 299 | 300 | 301 | 302 | 303 | 304 | 305 | 306 | 307 | 308 | 309 | 310 | 311 | 312 | 313 | 314 | 315 | 316 | 317 | 318 | 319 | 320 | 321 | 322 | 323 | 324 | 325 | 326 | 327 | 328 | 329 | 330 | 331 | 332 | 333 | 334 | 335 | 336 | 337 | 338 | 339 | 340 | 341 | 342 | 343 | 344 | 345 | 346 | 347 | 348 | 349 | 350 | 351 | 352 | 353 | 354 | 355 | 356 | 357 | 358 | 359 | 360 | 361 | 362 | 363 | 364 | 365 | 366 |
 


Product List

CYCLOPROPANECARBOXYLIC ACID, 1-[(1-METHYLETHENYL)AMINO]-, METHYL ESTER (9CI)
CAS:148930-75-0
Formula: C8H13NO2
CB282735
CYCLOPROPANECARBOXYLIC ACID, 1-[(2-AMINO-1-OXOPROPYL)AMINO]-, ETHYL ESTER, (S)- (9CI)
CAS:181467-71-0
Formula: C9H16N2O3
CB296116
CYCLOPROPANECARBOXYLIC ACID, 1-[(2-CYANOETHYL)AMINO]- (9CI)
CAS:109577-96-0
Formula: C7H10N2O2
CB258949
CYCLOPROPANECARBOXYLIC ACID, 1-[(ACETYLAMINO)METHYL]- (9CI)
CAS:205173-55-3
Formula: C7H11NO3
CB315209
CYCLOPROPANECARBOXYLIC ACID, 1-[(CYANOMETHYL)FORMYLAMINO]- (9CI)
CAS:109577-89-1
Formula: C7H8N2O3
CB258948
CYCLOPROPANECARBOXYLIC ACID, 1-[(ETHOXYCARBONYL)AMINO]-2,2-DIMETHYL- (9CI)
CAS:159279-74-0
Formula: C9H15NO4
CB289044
CYCLOPROPANECARBOXYLIC ACID, 1-[(ETHOXYCARBONYL)AMINO]-2-FLUORO- (9CI)
CAS:188897-46-3
Formula: C7H10FNO4
CB298092
CYCLOPROPANECARBOXYLIC ACID, 1-[(ETHOXYCARBONYL)AMINO]-2-FLUORO-, METHYL ESTER (9CI)
CAS:188897-48-5
Formula: C8H12FNO4
CB298094
CYCLOPROPANECARBOXYLIC ACID, 1-[(HYDROXYAMINO)CARBONYL]- (9CI)
CAS:168982-26-1
Formula: C5H7NO4
CB291854
CYCLOPROPANECARBOXYLIC ACID, 1-[(METHOXYCARBONYL)AMINO]-2,2-DIMETHYL- (9CI)
CAS:128753-44-6
Formula: C8H13NO4
CB271294
CYCLOPROPANECARBOXYLIC ACID, 1-[(METHOXYCARBONYL)METHYLAMINO]-, METHYL ESTER
CAS:387845-35-4
Formula: C8H13NO4
CB339214
CYCLOPROPANECARBOXYLIC ACID, 1-[(PHENYLMETHYL)AMINO]- (9CI)
CAS:119111-62-5
Formula: C11H13NO2
CB265107
CYCLOPROPANECARBOXYLIC ACID, 1-[(PHENYLMETHYL)AMINO]-, METHYL ESTER (9CI)
CAS:119111-70-5
Formula: C12H15NO2
CB265109
CYCLOPROPANECARBOXYLIC ACID, 1-[(TRIMETHYLSILYL)AMINO]-, METHYL ESTER (9CI)
CAS:153362-12-0
Formula: C8H17NO2Si
CB286351
CYCLOPROPANECARBOXYLIC ACID, 1-[[(1,1-DIMETHYLETHOXY)CARBONYL]AMINO]-2-ETHENYL-, (1R,2S)-REL-
CAS:213316-50-8
Formula: #
CB317011
CYCLOPROPANECARBOXYLIC ACID, 1-[[(1,1-DIMETHYLETHOXY)CARBONYL]AMINO]-2-FLUORO-
CAS:188897-47-4
Formula: C9H14FNO4
CB298093
CYCLOPROPANECARBOXYLIC ACID, 1-[[(1-AMINOCYCLOPROPYL)CARBONYL]AMINO]-, METHYL
CAS:123519-22-2
Formula: C9H14N2O3
CB267828
CYCLOPROPANECARBOXYLIC ACID, 1-[[(1-METHYLETHOXY)CARBONYL]AMINO]- (9CI)
CAS:259823-85-3
Formula: C8H13NO4
CB322454
CYCLOPROPANECARBOXYLIC ACID, 1-[[(1-METHYLETHOXY)CARBONYL]AMINO]-, METHYL ESTER (9CI)
CAS:148930-74-9
Formula: C9H15NO4
CB282734
CYCLOPROPANECARBOXYLIC ACID, 1-[[(1-OXOBUTYL)AMINO]METHYL]-
CAS:205173-57-5
Formula: C9H15NO3
CB315211
CYCLOPROPANECARBOXYLIC ACID, 1-[[(1-OXOPROPYL)AMINO]METHYL]-
CAS:205173-56-4
Formula: C8H13NO3
CB315210
CYCLOPROPANECARBOXYLIC ACID, 1-[[(2-METHYL-1-OXOPROPYL)AMINO]METHYL]-
CAS:205173-58-6
Formula: C9H15NO3
CB315212
CYCLOPROPANECARBOXYLIC ACID, 1-[[(ACETYLAMINO)CARBONYL]AMINO]-, METHYL ESTER (9CI)
CAS:148930-73-8
Formula: C8H12N2O4
CB282733
CYCLOPROPANECARBOXYLIC ACID, 1-[[(BUTYLAMINO)CARBONYL]AMINO]- (9CI)
CAS:401628-89-5
Formula: C9H16N2O3
CB346069
CYCLOPROPANECARBOXYLIC ACID, 1-ACETYL-2-ETHYL-, METHYL ESTER (9CI)
CAS:144465-34-9
Formula: C9H14O3
CB280019
CYCLOPROPANECARBOXYLIC ACID, 1-ACETYL-2-METHYL-, METHYL ESTER, CIS- (9CI)
CAS:129432-93-5
Formula: C8H12O3
CB271690
CYCLOPROPANECARBOXYLIC ACID, 1-ACETYL-2-METHYL-, METHYL ESTER, TRANS- (9CI)
CAS:129433-04-1
Formula: C8H12O3
CB271691
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-, ION(1-) (9CI)
CAS:149441-00-9
Formula: C4H6NO2
CB283080
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-, PROPYL ESTER (9CI)
CAS:104544-05-0
Formula: C7H13NO2
CB255882
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2,2-DIMETHYL-, (1S)- (9CI)
CAS:130930-42-6
Formula: C6H11NO2
CB272636
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2,2-DIMETHYL-, TRIMETHYLSILYL ESTER (9CI)
CAS:128753-46-8
Formula: C9H19NO2Si
CB271295
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2,3-DIMETHYL- (9CI)
CAS:116498-06-7
Formula: C6H11NO2
CB263477
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2,3-DIMETHYL-, (1ALPHA,2ALPHA,3ALPHA)- (9CI)
CAS:116498-01-2
Formula: C6H11NO2
CB263475
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2,3-DIMETHYL-, (1ALPHA,2ALPHA,3BETA)- (9CI)
CAS:103348-90-9
Formula: C6H11NO2
CB254924
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2,3-DIMETHYL-, (1ALPHA,2BETA,3BETA)- (9CI)
CAS:116498-02-3
Formula: C6H11NO2
CB263476
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2,3-DIMETHYL-, STEREOISOMER (9CI)
CAS:116500-72-2
Formula: C6H11NO2
CB263478
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(1-METHYLETHYL)- (9CI)
CAS:162679-89-2
Formula: C7H13NO2
CB290193
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(1-METHYLETHYL)-, (1R-CIS)- (9CI)
CAS:162871-01-4
Formula: C7H13NO2
CB290278
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(1-METHYLETHYL)-, (1R-TRANS)- (9CI)
CAS:162679-90-5
Formula: C7H13NO2
CB290194
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(1-METHYLETHYL)-, (1S,2R)- (9CI)
CAS:162679-91-6
Formula: C7H13NO2
CB290195
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(1-METHYLETHYL)-, (1S-CIS)- (9CI)
CAS:162871-02-5
Formula: C7H13NO2
CB290279
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(1-METHYLETHYL)-, CIS- (9CI)
CAS:149811-53-0
Formula: C7H13NO2
CB283327
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(1-METHYLETHYL)-, TRANS- (9CI)
CAS:149811-52-9
Formula: C7H13NO2
CB283326
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(2-HYDROXYETHYL)- (9CI)
CAS:153536-18-6
Formula: C6H11NO3
CB286447
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(2-HYDROXYETHYL)-, (1R,2R)-REL- (9CI)
CAS:329354-22-5
Formula: C6H11NO3
CB334258
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(2-PHENYLETHYL)-, (1S-CIS)- (9CI)
CAS:177540-27-1
Formula: C12H15NO2
CB294918
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(3-HYDROXYPHENYL)-, (1R-CIS)- (9CI)
CAS:139561-07-2
Formula: C10H11NO3
CB277784
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(3-HYDROXYPHENYL)-, (1S-CIS)- (9CI)
CAS:139561-08-3
Formula: C10H11NO3
CB277785
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(3-HYDROXYPHENYL)-, (1S-TRANS)- (9CI)
CAS:139561-06-1
Formula: C10H11NO3
CB277783
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)- (9CI)
CAS:153610-74-3
Formula: C5H9NO3
CB286489
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-, (1R,2R)- (9CI)
CAS:136378-52-4
Formula: C5H9NO3
CB275881
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-, (1R,2R)-REL- (9CI)
CAS:112575-35-6
Formula: C5H9NO3
CB261030
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-, (1S,2R)- (9CI)
CAS:125876-15-5
Formula: C5H9NO3
CB269569
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-, (1S-TRANS)- (9CI)
CAS:125876-14-4
Formula: C5H9NO3
CB269568
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-, CIS- (9CI)
CAS:146453-45-4
Formula: C5H9NO3
CB281120
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-, METHYL ESTER,
CAS:119066-43-2
Formula: C6H11NO3
CB265086
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-, METHYL ESTER, (1S-
CAS:114498-10-1
Formula: C6H11NO3
CB262173
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-3-METHYL- (9CI)
CAS:146400-24-0
Formula: C6H11NO3
CB281071
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(HYDROXYMETHYL)-3-PHENYL- (9CI)
CAS:146400-26-2
Formula: C11H13NO3
CB281073
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(METHOXYMETHYL)- (9CI)
CAS:146433-35-4
Formula: C6H11NO3
CB281108
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-(PHOSPHONOMETHYL)-, (1R,2S)-REL-
CAS:133753-34-1
Formula: C5H10NO5P
CB274364
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-[(PHENYLAMINO)METHYL]-, (1R,2R)- (9CI)
CAS:244233-43-0
Formula: C11H14N2O2
CB320844
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-[(PHENYLAMINO)METHYL]-, (1R,2S)- (9CI)
CAS:244233-42-9
Formula: C11H14N2O2
CB320843
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-CHLORO- (9CI)
CAS:162577-18-6
Formula: C4H6ClNO2
CB290159
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-CHLORO-, (1R-CIS)- (9CI)
CAS:163180-54-9
Formula: C4H6ClNO2
CB290396
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-CHLORO-, (1R-TRANS)- (9CI)
CAS:162989-67-5
Formula: C4H6ClNO2
CB290313
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-CHLORO-, (1S-CIS)- (9CI)
CAS:163180-55-0
Formula: C4H6ClNO2
CB290397
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-CHLORO-, (1S-TRANS)- (9CI)
CAS:163180-53-8
Formula: C4H6ClNO2
CB290395
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHENYL-, (1R,2S)-REL- (9CI)
CAS:213316-51-9
Formula: C6H9NO2
CB317012
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHENYL-, (1S,2R)- (9CI)
CAS:208941-76-8
Formula: C6H9NO2
CB316185
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHENYL-, (1S-CIS)- (9CI)
CAS:159700-57-9
Formula: C6H9NO2
CB289221
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHENYL-, ETHYL ESTER, (1R,2S)-REL- (9CI)
CAS:213316-32-6
Formula: C8H13NO2
CB317010
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHENYL-, ETHYL ESTER, (2S)- (9CI)
CAS:259221-73-3
Formula: C8H13NO2
CB322360
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHENYL-, ETHYL ESTER, HYDROCHLORIDE (1:1), (1R,2S)-
CAS:259214-56-7
Formula: C8H13NO2 HCl
CB322357
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHENYL-, ETHYL ESTER, HYDROCHLORIDE (1:1),(1R,2S)-REL-
CAS:259214-54-5
Formula: C8H13NO2 HCl
CB322356
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHYL-, (2S)- (9CI)
CAS:259254-47-2
Formula: C6H11NO2
CB322378
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHYL-, METHYL ESTER, (1R,2S)-REL- (9CI)
CAS:478945-20-9
Formula: C7H13NO2
CB351868
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHYL-, METHYL ESTER, (1R-CIS)- (9CI)
CAS:138457-96-2
Formula: C7H13NO2
CB277129
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHYL-, METHYL ESTER, (1S-CIS)- (9CI)
CAS:138457-95-1
Formula: C7H13NO2
CB277128
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-ETHYL-, METHYL ESTER, (1S-TRANS)- (9CI)
CAS:138457-97-3
Formula: C7H13NO2
CB277130
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-METHYL-, METHYL ESTER, HYDROCHLORIDE, TRANS- (9CI)
CAS:156258-66-1
Formula: C6H12ClNO2
CB287908
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-PHENYL-, METHYL ESTER, (1R,2R)-REL-
CAS:123039-88-3
Formula: C11H13NO2
CB267486
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-PHENYL-, METHYL ESTER, (1R,2S)-REL-
CAS:197778-15-7
Formula: C11H13NO2
CB284944
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-PHENYL-, METHYL ESTER, (1R-CIS)- (9CI)
CAS:110769-84-1
Formula: C11H13NO2
CB259559
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-PHENYL-, METHYL ESTER, (1R-TRANS)-
CAS:123806-63-3
Formula: C11H13NO2
CB267984
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-PHENYL-, METHYL ESTER, (1S-CIS)- (9CI)
CAS:110769-86-3
Formula: C11H13NO2
CB259560
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-PHENYL-, METHYL ESTER, (1S-TRANS)-
CAS:123806-65-5
Formula: C11H13NO2
CB267985
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-2-PROPYL-, (1S,2S)- (9CI)
CAS:136328-39-7
Formula: C7H13NO2
CB275849
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-3-(HYDROXYMETHYL)-2,2-DIMETHYL-, CIS- (9CI)
CAS:146400-42-2
Formula: C7H13NO3
CB281074
CYCLOPROPANECARBOXYLIC ACID, 1-AMINO-3-(HYDROXYMETHYL)-2,2-DIMETHYL-, TRANS- (9CI)
CAS:146400-25-1
Formula: C7H13NO3
CB281072
CYCLOPROPANECARBOXYLIC ACID, 1-CYANO-, HYDRAZIDE (9CI)
CAS:401825-00-1
Formula: C5H7N3O
CB346110
CYCLOPROPANECARBOXYLIC ACID, 1-CYANO-2,2,3-TRIMETHYL- (9CI)
CAS:259823-88-6
Formula: C8H11NO2
CB322455
CYCLOPROPANECARBOXYLIC ACID, 1-CYANO-2,2-DIFLUORO- (9CI)
CAS:51504-06-4
Formula: C5H3F2NO2
CB357435
CYCLOPROPANECARBOXYLIC ACID, 1-CYANO-2-(1-METHYLETHYL)-, METHYL ESTER, CIS- (9CI)
CAS:102363-74-6
Formula: C9H13NO2
CB254120
CYCLOPROPANECARBOXYLIC ACID, 1-CYANO-2-(1-METHYLETHYL)-, METHYL ESTER, TRANS- (9CI)
CAS:111735-81-0
Formula: C9H13NO2
CB260394
CYCLOPROPANECARBOXYLIC ACID, 1-ETHENYL-, ETHYL ESTER (9CI)
CAS:146857-44-5
Formula: C8H12O2
CB281343
CYCLOPROPANECARBOXYLIC ACID, 1-ETHENYL-2-ETHOXY-, 1,1-DIMETHYLETHYL ESTER, TRANS- (9CI)
CAS:142038-40-2
Formula: C12H20O3
CB278720
CYCLOPROPANECARBOXYLIC ACID, 1-ETHYNYL-2,2-DIMETHYL-, METHYL ESTER (9CI)
CAS:153943-63-6
Formula: C9H12O2
CB286670
CYCLOPROPANECARBOXYLIC ACID, 1-ETHYNYL-2-METHYL-, METHYL ESTER, CIS- (9CI)
CAS:153943-62-5
Formula: C8H10O2
CB286669
CYCLOPROPANECARBOXYLIC ACID, 1-ETHYNYL-2-METHYL-, METHYL ESTER, TRANS- (9CI)
CAS:153943-61-4
Formula: C8H10O2
CB286668
CYCLOPROPANECARBOXYLIC ACID, 1-FLUORO-2-(1-METHYLETHYL)- (9CI)
CAS:343929-20-4
Formula: C7H11FO2
CB335812
CYCLOPROPANECARBOXYLIC ACID, 1-FLUORO-2-(1-METHYLETHYL)-, ETHYL ESTER (9CI)
CAS:343867-06-1
Formula: C9H15FO2
CB335767
CYCLOPROPANECARBOXYLIC ACID, 1-FORMYL-2-METHYL-, ETHYL ESTER (9CI)
CAS:260261-27-6
Formula: C8H12O3
CB322484
CYCLOPROPANECARBOXYLIC ACID, 1-HYDROXY-2-METHYL-, ETHYL ESTER (9CI)
CAS:344248-71-1
Formula: C7H12O3
CB335867
CYCLOPROPANECARBOXYLIC ACID, 1-METHOXY-, ETHYL ESTER (9CI)
CAS:426828-30-0
Formula: C7H12O3
CB348057
CYCLOPROPANECARBOXYLIC ACID, 1-METHYL-, 2-(AMINOCARBONYL)HYDRAZIDE (9CI)
CAS:132997-28-5
Formula: C6H11N3O2
CB273952
CYCLOPROPANECARBOXYLIC ACID, 1-METHYL-2-METHYLENE-, ETHYL ESTER (9CI)
CAS:55281-55-5
Formula: C8H12O2
CB363025
CYCLOPROPANECARBOXYLIC ACID, 1-PROPYL-, METHYL ESTER (9CI)
CAS:104131-81-9
Formula: C8H14O2
CB255556
CYCLOPROPANECARBOXYLIC ACID, 2,2,3,3-TETRAFLUORO- (9CI)
CAS:344324-87-4
Formula: C4H2F4O2
CB335952
CYCLOPROPANECARBOXYLIC ACID, 2,2-DICYANO-, METHYL ESTER (9CI)
CAS:39822-30-5
Formula: C7H6N2O2
CB332102
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIFLUORO-, ETHYL ESTER (9CI)
CAS:151324-64-0
Formula: C6H8F2O2
CB285483
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIFLUORO-3,3-DIMETHYL- (9CI)
CAS:131262-35-6
Formula: C6H8F2O2
CB272860
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-, ETHYL ESTER, (-)- (9CI)
CAS:473717-80-5
Formula: C8H14O2
CB350887
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-, METHYL ESTER, (+)- (9CI)
CAS:172419-34-0
Formula: C7H12O2
CB293002
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-1-(METHYLENEAMINO)-, ETHYL ESTER (9CI)
CAS:412346-43-1
Formula: C9H15NO2
CB347301
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-3-(1-PROPENYL)-, (1R,3R)- (9CI)
CAS:249766-02-7
Formula: C9H14O2
CB321291
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-3-(1-PROPENYL)-, (1R,3S)-REL- (9CI)
CAS:482577-31-1
Formula: C9H14O2
CB352191
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-3-(1E)-1-PROPENYL-, (1R,3R)-REL- (9CI)
CAS:240494-66-0
Formula: C9H14O2
CB320573
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-3-(1Z)-1-PROPENYL-, (1R,3R)-REL- (9CI)
CAS:247921-00-2
Formula: C9H14O2
CB321200
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYL-3-NITRO-, ETHYL ESTER (9CI)
CAS:174574-81-3
Formula: C8H13NO4
CB293709
CYCLOPROPANECARBOXYLIC ACID, 2,2-DIMETHYLPROPYL ESTER (9CI)
CAS:404952-79-0
Formula: C9H16O2
CB346463
CYCLOPROPANECARBOXYLIC ACID, 2,3-DICHLORO- (9CI)
CAS:187250-64-2
Formula: C4H4Cl2O2
CB297582
CYCLOPROPANECARBOXYLIC ACID, 2-(1,2-DIHYDROXYETHYL)-, METHYL ESTER,
CAS:146144-30-1
Formula: C7H12O4
CB280935
CYCLOPROPANECARBOXYLIC ACID, 2-(1,2-DIHYDROXYETHYL)-, METHYL ESTER, [1ALPHA,2BETA(S*)]-
CAS:146061-88-3
Formula: C7H12O4
CB280886
CYCLOPROPANECARBOXYLIC ACID, 2-(1,3-BUTADIENYL)-, METHYL ESTER, [1ALPHA,2ALPHA(E)]-
CAS:100515-95-5
Formula: C9H12O2
CB252755
CYCLOPROPANECARBOXYLIC ACID, 2-(1,3-BUTADIENYL)-, METHYL ESTER, [1ALPHA,2BETA(E)]-
CAS:100678-75-9
Formula: C9H12O2
CB252847
CYCLOPROPANECARBOXYLIC ACID, 2-(1-HYDROXYETHYL)-, METHYL ESTER, (1R,2R)-REL-
CAS:245096-65-5
Formula: C7H12O3
CB320922
CYCLOPROPANECARBOXYLIC ACID, 2-(1-METHYLETHENYL)-, METHYL ESTER, TRANS-(-)-
CAS:52148-73-9
Formula: C8H12O2
CB358204
CYCLOPROPANECARBOXYLIC ACID, 2-(1-METHYLETHYL)-2-(2-OXOETHYL)- (9CI)
CAS:244793-42-8
Formula: C9H14O3
CB320889
CYCLOPROPANECARBOXYLIC ACID, 2-(1-METHYLETHYL)-3-NITRO-, ETHYL ESTER (9CI)
CAS:174574-80-2
Formula: C9H15NO4
CB293708
CYCLOPROPANECARBOXYLIC ACID, 2-(1-OXOBUTYL)-, TRANS- (9CI)
CAS:178683-13-1
Formula: C8H12O3
CB295284
CYCLOPROPANECARBOXYLIC ACID, 2-(1-OXOPROPYL)-, METHYL ESTER (9CI)
CAS:212137-01-4
Formula: C8H12O3
CB316787
CYCLOPROPANECARBOXYLIC ACID, 2-(1-PROPENYL)-, METHYL ESTER, [1ALPHA,2BETA(E)]- (9CI)
CAS:176852-12-3
Formula: C8H12O2
CB294737
CYCLOPROPANECARBOXYLIC ACID, 2-(1E)-1-PROPENYL-, ETHYL ESTER (9CI)
CAS:263772-24-3
Formula: C9H14O2
CB322962
CYCLOPROPANECARBOXYLIC ACID, 2-(2-PROPENYL)-, ETHYL ESTER, (1R,2S)-REL- (9CI)
CAS:433731-96-5
Formula: C9H14O2
CB348347
CYCLOPROPANECARBOXYLIC ACID, 2-(2-PROPENYL)-, METHYL ESTER, TRANS- (9CI)
CAS:34529-10-7
Formula: C8H12O2
CB331345
CYCLOPROPANECARBOXYLIC ACID, 2-(3-OXOBUTYL)-, CIS- (9CI)
CAS:176791-03-0
Formula: C8H12O3
CB294720
CYCLOPROPANECARBOXYLIC ACID, 2-(4-METHOXYPHENYL)-, (1R,2R)-REL-
CAS:34919-28-3
Formula: C11H12O3
CB331661
CYCLOPROPANECARBOXYLIC ACID, 2-(4-METHYLPHENYL)-, HYDRAZIDE (9CI)
CAS:438219-20-6
Formula: C11H14N2O
CB348653
CYCLOPROPANECARBOXYLIC ACID, 2-(4-NITROPHENYL)-, (1R,2R)-REL-
CAS:16633-46-8
Formula: C10H9NO4
CB247428
CYCLOPROPANECARBOXYLIC ACID, 2-(ACETYLOXY)-, METHYL ESTER, CIS- (9CI)
CAS:168141-89-7
Formula: C7H10O4
CB291677
CYCLOPROPANECARBOXYLIC ACID, 2-(ACETYLOXY)-, METHYL ESTER, TRANS- (9CI)
CAS:168141-88-6
Formula: C7H10O4
CB291676
CYCLOPROPANECARBOXYLIC ACID, 2-(AMINOMETHYL)-, METHYL ESTER, HYDROCHLORIDE, CIS- (9CI)
CAS:132592-83-7
Formula: C6H12ClNO2
CB273699
CYCLOPROPANECARBOXYLIC ACID, 2-(AMINOMETHYL)-, METHYL ESTER, HYDROCHLORIDE, TRANS- (9CI)
CAS:132592-84-8
Formula: C6H12ClNO2
CB273700
CYCLOPROPANECARBOXYLIC ACID, 2-(AMINOMETHYL)-, METHYL ESTER, TRANS- (9CI)
CAS:159786-56-8
Formula: C6H11NO2
CB289257
CYCLOPROPANECARBOXYLIC ACID, 2-(AMINOMETHYL)-2-METHYL-, METHYL ESTER, TRANS-
CAS:132592-87-1
Formula: C7H13NO2
CB273701
CYCLOPROPANECARBOXYLIC ACID, 2-(BROMOACETYL)-, METHYL ESTER, TRANS- (9CI)
CAS:128515-13-9
Formula: C7H9BrO3
CB271143
CYCLOPROPANECARBOXYLIC ACID, 2-(CHLOROCARBONYL)-, ETHYL ESTER (9CI)
CAS:178687-20-2
Formula: C7H9ClO3
CB295290
CYCLOPROPANECARBOXYLIC ACID, 2-(CHLOROCARBONYL)-, METHYL ESTER, (1R,2S)-REL- (9CI)
CAS:53229-56-4
Formula: C6H7ClO3
CB359192
CYCLOPROPANECARBOXYLIC ACID, 2-(CHLOROCARBONYL)-1,2-DIMETHYL-, CIS- (9CI)
CAS:119908-77-9
Formula: C7H9ClO3
CB265603
CYCLOPROPANECARBOXYLIC ACID, 2-(HYDROXYMETHYL)-, ETHYL ESTER, (1S-TRANS)- (9CI)
CAS:109716-55-4
Formula: C7H12O3
CB259018
CYCLOPROPANECARBOXYLIC ACID, 2-(HYDROXYMETHYL)-1-METHYL-, ETHYL ESTER,
CAS:439913-09-4
Formula: C8H14O3
CB348854
CYCLOPROPANECARBOXYLIC ACID, 2-(HYDROXYMETHYL)-1-METHYL-, METHYL ESTER, TRANS-
CAS:107805-14-1
Formula: C7H12O3
CB258011
CYCLOPROPANECARBOXYLIC ACID, 2-(HYDROXYMETHYL)-2-METHYL-, METHYL ESTER, TRANS-
CAS:127722-17-2
Formula: C7H12O3
CB270679
CYCLOPROPANECARBOXYLIC ACID, 2-(HYDROXYMETHYL)-3-METHYL-, METHYL ESTER,
CAS:312910-87-5
Formula: C7H12O3
CB333236
CYCLOPROPANECARBOXYLIC ACID, 2-[(ACETYLAMINO)METHYL]-, (1R,2R)-REL- (9CI)
CAS:213757-85-8
Formula: C7H11NO3
CB317127
CYCLOPROPANECARBOXYLIC ACID, 2-[(ACETYLAMINO)METHYL]-, (1R,2S)-REL- (9CI)
CAS:213757-81-4
Formula: C7H11NO3
CB317126
CYCLOPROPANECARBOXYLIC ACID, 2-[(ACETYLOXY)METHYL]-, (1R-TRANS)- (9CI)
CAS:201337-81-7
Formula: C7H10O4
CB314329
CYCLOPROPANECARBOXYLIC ACID, 2-[(ACETYLOXY)METHYL]-, (1S,2S)- (9CI)
CAS:223800-41-7
Formula: C7H10O4
CB319395
CYCLOPROPANECARBOXYLIC ACID, 2-[[(TRANS-4-ETHYLCYCLOHEXYL)AMINO]CARBONYL]-,
CAS:452910-07-5
Formula: C13H21NO3
CB349776
CYCLOPROPANECARBOXYLIC ACID, 2-[[[(1,1-DIMETHYLETHOXY)CARBONYL]AMINO]METHYL]-,
CAS:253779-06-5
Formula: C10H17NO4
CB321826
CYCLOPROPANECARBOXYLIC ACID, 2-[4-(1,1-DIMETHYLETHYL)PHENYL]-, HYDRAZIDE (9CI)
CAS:438616-66-1
Formula: C14H20N2O
CB348744
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-, (1R-CIS)- (9CI)
CAS:178033-28-8
Formula: C6H8O3
CB295072
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-, METHYL ESTER (9CI)
CAS:143955-12-8
Formula: C7H10O3
CB279729
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-, METHYL ESTER, (1R-CIS)- (9CI)
CAS:178033-26-6
Formula: C7H10O3
CB295071
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-, METHYL ESTER, (1R-TRANS)- (9CI)
CAS:116949-59-8
Formula: C7H10O3
CB263793
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-, METHYL ESTER, (1S-CIS)- (9CI)
CAS:116949-58-7
Formula: C7H10O3
CB263792
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-1,2-DIMETHYL-, METHYL ESTER (9CI)
CAS:412281-37-9
Formula: C9H14O3
CB347171
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-2-METHYL-, METHYL ESTER (9CI)
CAS:113503-39-2
Formula: C8H12O3
CB261533
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-3-METHYL-, ETHYL ESTER, (1ALPHA,2ALPHA,3BETA)- (9CI)
CAS:189628-52-2
Formula: C9H14O3
CB298346
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-3-METHYL-, ETHYL ESTER, (1ALPHA,2BETA,3BETA)- (9CI)
CAS:189628-62-4
Formula: C9H14O3
CB298347
CYCLOPROPANECARBOXYLIC ACID, 2-ACETYL-3-METHYL-, ETHYL ESTER, (1R,2R,3R)-REL-
CAS:189628-51-1
Formula: C9H14O3
CB298345
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-1,2-DIMETHYL-, METHYL ESTER (6CI)
CAS:100313-90-4
Formula: C8H11NO2
CB252591
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-1,2-DIMETHYL-, METHYL ESTER, CIS- (9CI)
CAS:57234-24-9
Formula: C8H11NO2
CB367552
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-1,2-DIMETHYL-, METHYL ESTER, TRANS- (9CI)
CAS:57234-25-0
Formula: C8H11NO2
CB367553
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-1-ETHENYL-, METHYL ESTER, CIS- (9CI)
CAS:51171-66-5
Formula: C8H9NO2
CB357061
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-1-ETHENYL-, METHYL ESTER, TRANS- (9CI)
CAS:51171-67-6
Formula: C8H9NO2
CB357062
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-1-METHYL-, ETHYL ESTER, CIS- (9CI)
CAS:142653-21-2
Formula: C8H11NO2
CB279021
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-1-METHYL-, ETHYL ESTER, TRANS- (9CI)
CAS:142653-22-3
Formula: C8H11NO2
CB279022
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-2-ETHENYL-, METHYL ESTER, CIS- (9CI)
CAS:51171-68-7
Formula: C8H9NO2
CB357063
CYCLOPROPANECARBOXYLIC ACID, 2-CYANO-2-ETHENYL-, METHYL ESTER, TRANS- (9CI)
CAS:51213-13-9
Formula: C8H9NO2
CB357103
CYCLOPROPANECARBOXYLIC ACID, 2-ETHENYL-, ETHYL ESTER, (1S,2R)- (9CI)
CAS:200013-10-1
Formula: C8H12O2
CB314047
CYCLOPROPANECARBOXYLIC ACID, 2-ETHENYL-, ETHYL ESTER, (1S,2S)- (9CI)
CAS:240404-80-2
Formula: C8H12O2
CB320550
CYCLOPROPANECARBOXYLIC ACID, 2-ETHOXY-, ETHYL ESTER, (1R,2S)- (9CI)
CAS:492468-17-4
Formula: C8H14O3
CB352646
CYCLOPROPANECARBOXYLIC ACID, 2-ETHOXY-1-METHYL-, METHYL ESTER (9CI)
CAS:344354-79-6
Formula: C8H14O3
CB336038
CYCLOPROPANECARBOXYLIC ACID, 2-ETHOXY-2-PHENYL- (9CI)
CAS:344334-39-0
Formula: C12H14O3
CB336012
CYCLOPROPANECARBOXYLIC ACID, 2-ETHOXY-3-METHYL-, 1,1-DIMETHYLETHYL ESTER, (1ALPHA,2ALPHA,3BA)- (9CI)
CAS:145164-86-9
Formula: C11H20O3
CB280455
CYCLOPROPANECARBOXYLIC ACID, 2-ETHOXY-3-METHYL-, 1,1-DIMETHYLETHYL ESTER, (1ALPHA,2BA,3ALPHA)- (9CI)
CAS:145164-87-0
Formula: C11H20O3
CB280456
CYCLOPROPANECARBOXYLIC ACID, 2-ETHOXY-3-METHYL-, 1,1-DIMETHYLETHYL ESTER, (1ALPHA,2BA,3BA)- (9CI)
CAS:145059-79-6
Formula: C11H20O3
CB280374
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYL-, ETHYL ESTER (6CI)
CAS:115188-22-2
Formula: C8H14O2
CB262689
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYL-1-[(METHOXYCARBONYL)AMINO]-, METHYL ESTER (9CI)
CAS:343942-90-5
Formula: C9H15NO4
CB335824
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYL-3-ETHYLIDENE-, METHYL ESTER (9CI)
CAS:343867-78-7
Formula: C9H14O2
CB335772
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYL-3-METHYLENE-, ETHYL ESTER (9CI)
CAS:412345-05-2
Formula: C9H14O2
CB347297
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYLIDENE-3-METHYL-, METHYL ESTER, (1ALPHA,2E,3ALPHA)-
CAS:42419-01-2
Formula: C8H12O2
CB344383
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYLIDENE-3-METHYL-, METHYL ESTER, (1ALPHA,2E,3BETA)-
CAS:42419-00-1
Formula: C8H12O2
CB344382
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYLIDENE-3-METHYL-, METHYL ESTER, (1ALPHA,2Z,3ALPHA)-
CAS:42418-99-5
Formula: C8H12O2
CB344381
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYLIDENE-3-METHYL-, METHYL ESTER, (1ALPHA,2Z,3BETA)-
CAS:42418-98-4
Formula: C8H12O2
CB344380
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYNYL-1-METHYL-, METHYL ESTER, (1R,2S)-REL- (9CI)
CAS:221100-77-2
Formula: C8H10O2
CB318772
CYCLOPROPANECARBOXYLIC ACID, 2-ETHYNYL-2-METHYL- (9CI)
CAS:339292-22-7
Formula: C7H8O2
CB335109
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, 1,1-DIMETHYLETHYL ESTER, (1R,2R)-REL-
CAS:152237-14-4
Formula: C8H13FO2
CB285856
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, 1,1-DIMETHYLETHYL ESTER, TRANS- (9CI)
CAS:152237-15-5
Formula: C8H13FO2
CB285857
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, BUTYL ESTER, (1R,2R)-REL- (9CI)
CAS:161582-46-3
Formula: C8H13FO2
CB289810
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, BUTYL ESTER, (1R-CIS)- (9CI)
CAS:161814-30-8
Formula: C8H13FO2
CB289873
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, BUTYL ESTER, (1S,2S)- (9CI)
CAS:177933-52-7
Formula: C8H13FO2
CB295032
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, PROPYL ESTER, (1R,2R)-REL- (9CI)
CAS:216872-00-3
Formula: C7H11FO2
CB317825
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, PROPYL ESTER, (1R-CIS)- (9CI)
CAS:177564-61-3
Formula: C7H11FO2
CB294925
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-, PROPYL ESTER, (1S,2S)- (9CI)
CAS:177564-59-9
Formula: C7H11FO2
CB294924
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-1-METHYL-, ETHYL ESTER, CIS- (9CI)
CAS:128230-91-1
Formula: C7H11FO2
CB270984
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-1-METHYL-, ETHYL ESTER, TRANS- (9CI)
CAS:128230-92-2
Formula: C7H11FO2
CB270985
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-2-METHOXY-, METHYL ESTER, CIS- (9CI)
CAS:105783-72-0
Formula: C6H9FO3
CB256764
CYCLOPROPANECARBOXYLIC ACID, 2-FLUORO-2-METHOXY-, METHYL ESTER, TRANS- (9CI)
CAS:105783-74-2
Formula: C6H9FO3
CB256765
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-, ETHYL ESTER, (1R-TRANS)- (9CI)
CAS:109716-50-9
Formula: C7H10O3
CB259017
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-, ETHYL ESTER, (1S-TRANS)- (9CI)
CAS:109716-61-2
Formula: C7H10O3
CB259020
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-, METHYL ESTER, (1R,2S)-REL- (9CI)
CAS:52920-01-1
Formula: Formula:
CB359142
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-, METHYL ESTER, (1S,2R)- (9CI)
CAS:159000-41-6
Formula: C6H8O3
CB288944
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-1-METHYL-, ETHYL ESTER (9CI)
CAS:344355-14-2
Formula: C8H12O3
CB336042
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-1-METHYL-, ETHYL ESTER, (1R,2R)- (9CI)
CAS:439913-11-8
Formula: C8H12O3
CB348855
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-1-METHYL-, METHYL ESTER, CIS- (9CI)
CAS:107804-96-6
Formula: C7H10O3
CB258010
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-1-METHYL-, METHYL ESTER, TRANS- (9CI)
CAS:107804-95-5
Formula: C7H10O3
CB258009
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-2-(1-METHYLETHYL)- (9CI)
CAS:244793-40-6
Formula: C8H12O3
CB320887
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-3-METHYL-, ETHYL ESTER, (1R,3S)-REL- (9CI)
CAS:318990-36-2
Formula: C8H12O3
CB333624
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-3-METHYL-, METHYL ESTER, (1S,2R,3R)- (9CI)
CAS:312910-88-6
Formula: C7H10O3
CB333237
CYCLOPROPANECARBOXYLIC ACID, 2-FORMYL-3-METHYL-, METHYL ESTER, (1S,2S,3R)- (9CI)
CAS:312910-89-7
Formula: C7H10O3
CB333238
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-1,2-DIMETHYL-, METHYL ESTER (9CI)
CAS:344355-06-2
Formula: C8H14O3
CB336040
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-2-(1-METHYLETHYL)- (9CI)
CAS:344294-24-2
Formula: C8H14O3
CB335893
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-2-METHYL-, METHYL ESTER (9CI)
CAS:106711-03-9
Formula: C7H12O3
CB257354
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-3-(1-METHYLETHYL)- (9CI)
CAS:122775-02-4
Formula: C8H14O3
CB267358
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-3-(1-METHYLETHYL)-, (1ALPHA,2BA,3BA)- (9CI)
CAS:126639-20-1
Formula: C8H14O3
CB270011
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-3-METHYL-, METHYL ESTER (9CI)
CAS:126639-13-2
Formula: C7H12O3
CB270010
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-3-METHYL-, METHYL ESTER, (1ALPHA,2BETA,3ALPHA)-
CAS:122872-23-5
Formula: C7H12O3
CB267398
CYCLOPROPANECARBOXYLIC ACID, 2-METHOXY-3-METHYL-, METHYL ESTER, (1ALPHA,2BETA,3BETA)-
CAS:122775-07-9
Formula: C7H12O3
CB267359
CYCLOPROPANECARBOXYLIC ACID, 2-METHYL-, 1-METHYLETHYL ESTER (9CI)
CAS:473838-01-6
Formula: C8H14O2
CB350933
CYCLOPROPANECARBOXYLIC ACID, 2-METHYL-, 2-METHOXYETHYL ESTER (9CI)
CAS:473838-72-1
Formula: C8H14O3
CB350941
CYCLOPROPANECARBOXYLIC ACID, 2-METHYL-, PROPYL ESTER (9CI)
CAS:473838-75-4
Formula: C8H14O2
CB350942
CYCLOPROPANECARBOXYLIC ACID, 2-METHYL-2-NITRO-, TRANS- (9CI)
CAS:117078-04-3
Formula: C5H7NO4
CB263883
CYCLOPROPANECARBOXYLIC ACID, 2-METHYL-3-(2-METHYL-1-PROPENYL)-, (1ALPHA,2ALPHA,3ALPHA)- (9CI)
CAS:134876-15-6
Formula: C9H14O2
CB275010
CYCLOPROPANECARBOXYLIC ACID, 2-METHYL-3-(2-METHYL-1-PROPENYL)-, (1R,2S,3R)-REL- (9CI)
CAS:134876-16-7
Formula: C9H14O2
CB275011
CYCLOPROPANECARBOXYLIC ACID, 2-NITRO-, 1,1-DIMETHYLETHYL ESTER, (1R,2R)-REL-
CAS:148124-02-1
Formula: C8H13NO4
CB282279
CYCLOPROPANECARBOXYLIC ACID, 2-NITRO-, CIS- (8CI)
CAS:22882-44-6
Formula: C4H5NO4
CB305804
CYCLOPROPANECARBOXYLIC ACID, 2-NITRO-, METHYL ESTER, CIS- (8CI)
CAS:22882-46-8
Formula: C5H7NO4
CB305806
CYCLOPROPANECARBOXYLIC ACID, 2-NITRO-, METHYL ESTER, TRANS- (8CI)
CAS:22882-45-7
Formula: C5H7NO4
CB305805
CYCLOPROPANECARBOXYLIC ACID, 2-OXIRANYL-, METHYL ESTER, [1R-[1ALPHA,2ALPHA(S*)]]- (9CI)
CAS:157523-17-6
Formula: C7H10O3
CB288456
CYCLOPROPANECARBOXYLIC ACID, 2-PROPYL-, ETHYL ESTER, (1R,2R)- (9CI)
CAS:492468-15-2
Formula: C9H16O2
CB352645
CYCLOPROPANECARBOXYLIC ACID, 2-PROPYL-, ETHYL ESTER, (1R,2S)- (9CI)
CAS:492468-18-5
Formula: C9H16O2
CB352647
CYCLOPROPANECARBOXYLIC ACID, 2-PROPYL-, METHYL ESTER, CIS- (9CI)
CAS:168141-73-9
Formula: C8H14O2
CB291675
CYCLOPROPANECARBOXYLIC ACID, 2-PROPYL-, METHYL ESTER, TRANS- (9CI)
CAS:168141-72-8
Formula: C8H14O2
CB291674
CYCLOPROPANECARBOXYLIC ACID, 3-(CHLOROCARBONYL)-2,2-DIMETHYL-, METHYL ESTER, CIS- (9CI)
CAS:120591-67-5
Formula: C8H11ClO3
CB266051
CYCLOPROPANECARBOXYLIC ACID, 3-(CYANOMETHYL)-2,2-DIMETHYL- (9CI)
CAS:388623-23-2
Formula: C8H11NO2
CB339276
CYCLOPROPANECARBOXYLIC ACID, 3-(FLUOROETHYNYL)-2,2-DIMETHYL- (9CI)
CAS:403507-47-1
Formula: C8H9FO2
CB346196
CYCLOPROPANECARBOXYLIC ACID, 3-ACETYL-2,2-DIMETHYL- (9CI)
CAS:111869-21-7
Formula: C8H12O3
CB260513
CYCLOPROPANECARBOXYLIC ACID, 3-ETHENYL-2,2-DIMETHYL-, METHYL ESTER (9CI)
CAS:191998-91-1
Formula: C9H14O2
CB298856
CYCLOPROPANECARBOXYLIC ACID, 3-ETHENYL-2,2-DIMETHYL-, METHYL ESTER, (1S,3R)-
CAS:247129-72-2
Formula: C9H14O2
CB321130
CYCLOPROPANECARBOXYLIC ACID, 3-ETHENYL-2,2-DIMETHYL-, METHYL ESTER, (1S,3S)-
CAS:247129-73-3
Formula: C9H14O2
CB321131
CYCLOPROPANECARBOXYLIC ACID, 3-ETHOXY-2,2-DIMETHYL-, 1,1-DIMETHYLETHYL ESTER, CIS- (9CI)
CAS:145060-04-4
Formula: C12H22O3
CB280375
CYCLOPROPANECARBOXYLIC ACID, 3-ETHOXY-2,2-DIMETHYL-, 1,1-DIMETHYLETHYL ESTER, TRANS- (9CI)
CAS:145060-06-6
Formula: C12H22O3
CB280376
CYCLOPROPANECARBOXYLIC ACID, 3-FORMYL-2,2-DIMETHYL-, CIS- (9CI)
CAS:123620-81-5
Formula: C7H10O3
CB267869
CYCLOPROPANECARBOXYLIC ACID, 3-METHOXY-2,2-DIMETHYL-, METHYL ESTER (9CI)
CAS:344746-96-9
Formula: C8H14O3
CB336107
CYCLOPROPANECARBOXYLIC ACID, 3-METHYL-2-BUTENYL ESTER (9CI)
CAS:264145-76-8
Formula: C9H14O2
CB322989
CYCLOPROPANECARBOXYLIC ACID, AMINOCYCLOPROPYLIDENEMETHYLENE-, METHYL ESTER (9CI)
CAS:219788-05-3
Formula: C9H11NO2
CB318230
CYCLOPROPANECARBOXYLIC ACID, BUTYLIDENEHYDRAZIDE (9CI)
CAS:453516-14-8
Formula: C8H14N2O
CB349798
CYCLOPROPANECARBOXYLIC ACID, CYCLOPROPYLIDENE-, ETHYL ESTER (9CI)
CAS:136028-47-2
Formula: C9H12O2
CB275680
CYCLOPROPANECARBOXYLIC ACID, CYCLOPROPYLIDENE-, ETHYL ESTER, (1R)- (9CI)
CAS:259224-22-1
Formula: C9H12O2
CB322366
CYCLOPROPANECARBOXYLIC ACID, ETHYLIDENE-, ETHYL ESTER (9CI)
CAS:339363-55-2
Formula: C8H12O2
CB335145
CYCLOPROPANECARBOXYLIC ACID, METHYLENE-, 1,1-DIMETHYLETHYL ESTER (9CI)
CAS:219788-08-6
Formula: C9H14O2
CB318231
CYCLOPROPANECARBOXYLIC ACID, OXIRANYLMETHYL ESTER (9CI)
CAS:130433-14-6
Formula: C7H10O3
CB272372
CYCLOPROPANECARBOXYLIC ACID, THIOXO-, ETHYL ESTER (9CI)
CAS:362061-14-1
Formula: C6H8O2S
CB337710
CYCLOPROPANECARBOXYLIC ACID; SILVER
CAS:75112-77-5
Formula: C4H6AgO2
CB195880
CYCLOPROPANECARBOXYLIC ACID;TRIMETHYLENECARBOXYLIC ACID
CAS:1759-53-1
Formula: C4H6O2
CB55512
CYCLOPROPANECARBOXYLIC-2,2,3,3-D4ACID
CAS:89924-82-3
CB222785
CYCLOPROPANECARBOXYLICACID,(3Z)-3-HEXENYLESTER
CAS:188570-78-7
Formula: C10H16O2
CB297924
CYCLOPROPANECARBOXYLICACID,1-AMINO-,HYDRATE(2:1)(9CI)
CAS:126115-44-4
Formula: C4H7NO2.1/2H2O
CB269684
CYCLOPROPANECARBOXYLICACID,2-AMINO-(9CI)
CAS:124330-65-0
Formula: C4H7NO2
CB268494
CYCLOPROPANEETHANAMINE, 2-(2-ETHOXYPHENYL)-, CIS- (9CI)
CAS:149489-29-2
Formula: C13H19NO
CB283101
CYCLOPROPANEETHANAMINE, 2-(2-ETHOXYPHENYL)-, TRANS- (9CI)
CAS:149489-30-5
Formula: C13H19NO
CB283102
CYCLOPROPANEETHANIMIDOYL CHLORIDE, N-METHYL-ALPHA-OXO- (9CI)
CAS:124838-05-7
Formula: C6H8ClNO
CB268829
CYCLOPROPANEETHANOL, 2-ETHYL-, BENZOATE (9CI)
CAS:485787-12-0
Formula: C14H18O2
CB352342
CYCLOPROPANEETHANOL, 2-ETHYL-, BENZOATE, (1R,2R)-REL- (9CI)
CAS:458538-57-3
Formula: C14H18O2
CB349988
CYCLOPROPANEETHANOL, BETA-AMINO-3-HYDROXY-2,2-DIMETHYL-, (BETAR,1R,3S)-REL- (9CI)
CAS:408341-78-6
Formula: C7H15NO2
CB346809
CYCLOPROPANEMETHANAMINE HYDROCHLORIDE (1:1)
CAS:7252-53-1
Formula: C4H9ClN
CB189151
CYCLOPROPANEMETHANAMINE, 2-(2-FLUOROPHENYL)-, (1R,2R)-REL- (9CI)
CAS:372184-03-7
Formula: C10H12FN
CB338320
CYCLOPROPANEMETHANAMINE, 2-(4-FLUOROPHENYL)-, (1R,2R)-REL- (9CI)
CAS:372184-05-9
Formula: C10H12FN
CB338321
CYCLOPROPANEMETHANAMINE, 2-(4-PYRIDINYL)-, (1R,2R)-REL- (9CI)
CAS:372184-01-5
Formula: C9H12N2
CB338319
CYCLOPROPANEMETHANAMINE, N-(10,11-DIHYDRO-5H-DIBENZO(A,D)CYCLOHEPTEN-5-YLIDENE)-
CAS:59864-46-9
Formula: C19H19N
CB154370
CYCLOPROPANEMETHANOL, 1-(1-PYRROLIDINYL)- (9CI)
CAS:387845-17-2
Formula: C8H15NO
CB339210
CYCLOPROPANEMETHANOL, 1-(3-PYRIDINYL)- (9CI)
CAS:351421-96-0
Formula: C9H11NO
CB336768
CYCLOPROPANEMETHANOL, 1-ETHOXY-ALPHA-[(TRIMETHYLSILYL)ETHYNYL]- (9CI)
CAS:157022-44-1
Formula: C11H20O2Si
CB288257
CYCLOPROPANEMETHANOL, 2,2-DICHLORO-ALPHA-METHYL-, (R*,R*)- (9CI)
CAS:108431-59-0
Formula: C5H8Cl2O
CB259683
CYCLOPROPANEMETHANOL, 2,2-DICHLORO-ALPHA-METHYL-, (R*,S*)- (9CI)
CAS:108431-60-3
Formula: C5H8Cl2O
CB259684
CYCLOPROPANEMETHANOL, 2,2-DIFLUORO-, ACETATE (9CI)
CAS:233584-55-9
Formula: C6H8F2O2
CB320236
CYCLOPROPANEMETHANOL, 2-(3-PYRIDINYL)-, (1R,2R)-REL- (9CI)
CAS:484654-43-5
Formula: C9H11NO
CB352276
CYCLOPROPANEMETHANOL, 2-(3-PYRIDINYL)-, (1R,2S)-REL- (9CI)
CAS:484654-44-6
Formula: C9H11NO
CB352277
CYCLOPROPANEMETHANOL, 2-(4-ETHOXYPHENYL)-ALPHA,ALPHA-DIMETHYL-, (1R,2R)-REL- (9CI)
CAS:205674-81-3
Formula: C14H20O2
CB315314
CYCLOPROPANEMETHANOL, 2-(4-PYRIDINYL)- (9CI)
CAS:484654-35-5
Formula: C9H11NO
CB352272
CYCLOPROPANEMETHANOL, 2-(4-PYRIDINYL)-, (1R,2R)-REL- (9CI)
CAS:484654-36-6
Formula: C9H11NO
CB352273
CYCLOPROPANEMETHANOL, 2-BROMO-1-METHYL- (9CI)
CAS:343267-94-7
Formula: C5H9BrO
CB335562
CYCLOPROPANEMETHANOL, 2-BROMO-2-METHYL-, (1R,2R)-REL- (9CI)
CAS:473994-83-1
Formula: C5H9BrO
CB350970
CYCLOPROPANEMETHANOL,1-METHYL-2-[(1,2,2-TRIMETHYLBICYCLO[3.1.0]HEX-3-YL)METHYL]-
CAS:198404-98-7
Formula: C15H26O
CB285080
CYCLOPROPANEMETHANOL,2-AMINO-2-METHYL-,(1R,2S)-(9CI)
CAS:257877-94-4
Formula: C5H11NO
CB322164
CYCLOPROPANEMETHANOL,2-AMINO-3-METHYL-,(1-ALPHA-,2-ALPHA-,3-BTA-)-(9CI)
CAS:132697-04-2
Formula: C5H11NO
CB273758
CYCLOPROPANEMETHYLENIMINE, -ALPHA--METHYL-1-PHENYL- (8CI)
CAS:20127-48-4
Formula: C11H13N
CB302324
CYCLOPROPANENONANOIC ACID METHYL ESTER
CAS:10152-60-0
Formula: #
CB239299
CYCLOPROPANENONANOICACID,2-[
CAS:10152-69-9
Formula: #
CB239306
CYCLOPROPANEOCTANOICACID,
CAS:10152-61-1
Formula: #
CB239300
CYCLOPROPANEPROPANOIC ACID, -BTA--(AMINOMETHYL)--BTA--METHYL-
CAS:271580-11-1
Formula: C8H15NO2
CB323426
CYCLOPROPANEPROPANOIC ACID, 1-ACETYL-, METHYL ESTER (9CI)
CAS:280568-03-8
Formula: C9H14O3
CB323713
CYCLOPROPANEPROPANOIC ACID, ALPHA-AMINO-2-CYCLOPROPYLIDENE- (9CI)
CAS:213198-57-3
Formula: C9H13NO2
CB316985
CYCLOPROPANEPROPANOL, 1-(DIMETHYLAMINO)- (9CI)
CAS:387845-15-0
Formula: C8H17NO
CB339209
CYCLOPROPANESULFONAMIDE SODIUM SALT (1:1)
CAS:154350-28-4
Formula: C3H7NO2S
CB44840
CYCLOPROPANESULFONAMIDE;CYCLOPROPANESULFONYL AMIDE
CAS:154350-29-5
Formula: C3H7NO2S
CB44841
CYCLOPROPANESULFONIC ACID
CAS:21297-68-7
Formula: C3H6O3S
CB68813
CYCLOPROPANESULFONYL CHLORIDE
CAS:139631-62-2
Formula: C3H5ClO2S
CB35145
CYCLOPROPANETETRADECANOIC ACID, 2-OCTYL-, METHYL ESTER
CAS:52355-42-7
Formula: #
CB358424
CYCLOPROPANETHIOL, 2,2,3-TRIMETHYL-1-(1-METHYLETHYL)- (9CI)
CAS:205485-97-8
Formula: C9H18S
CB315265
CYCLOPROPANIMINE
CAS:54376-32-8
Formula: C3H5N
CB140315
CYCLOPROPANOL, 1-(1-HEXYNYL)- (9CI)
CAS:163211-82-3
Formula: C9H14O
CB290411
CYCLOPROPANOL, 1-(1E)-1-BUTENYL-2-ETHYL-, METHANESULFONATE, (1R,2S)-REL- (9CI)
CAS:478945-17-4
Formula: C10H18O3S
CB351867
CYCLOPROPANOL, 1-(2-PYRIDINYL)- (9CI)
CAS:138835-98-0
Formula: C8H9NO
CB277358
CYCLOPROPANOL, 1-(2-THIAZOLYLMETHYL)-
CAS:174183-99-4
Formula: C7H9NOS
CB293574
CYCLOPROPANOL, 1-(3,3-DIMETHYL-1-BUTYNYL)- (9CI)
CAS:208652-27-1
Formula: C9H14O
CB316119
CYCLOPROPANOL, 1-(4-HYDROXY-1-BUTYNYL)- (9CI)
CAS:208652-30-6
Formula: C7H10O2
CB316120
CYCLOPROPANOL, 1-(6-METHYL-4-PYRIMIDINYL)- (9CI)
CAS:116186-31-3
Formula: C8H10N2O
CB263271
CYCLOPROPANOL, 1-[(DIMETHYLAMINO)METHYL]-, ACETATE (ESTER) (9CI)
CAS:387844-89-5
Formula: C8H15NO2
CB339205
CYCLOPROPANOL, 1-[[(4S)-2,2-DIMETHYL-1,3-DIOXOLAN-4-YL]METHYL]-2-ETHYL- (9CI)
CAS:478944-82-0
Formula: C11H20O3
CB351865
CYCLOPROPANOL, 1-ETHENYL-2-ETHOXY-, METHANESULFONATE, (1R-CIS)- (9CI)
CAS:178899-57-5
Formula: C8H14O4S
CB295346
CYCLOPROPANOL, 1-ETHENYL-2-ETHOXY-, METHANESULFONATE, (1S-TRANS)- (9CI)
CAS:178751-94-5
Formula: C8H14O4S
CB295310
CYCLOPROPANOL, 1-ETHOXY-2-HEPTYL-, (1R,2S)- (9CI)
CAS:325961-85-1
Formula: C12H24O2
CB333990
CYCLOPROPANOL, 1-ETHOXY-2-PENTYL-, ACETATE, (1R,2R)- (9CI)
CAS:325961-76-0
Formula: C12H22O3
CB333989
CYCLOPROPANOL, 1-ETHOXY-2-PENTYL-, ACETATE, (1R,2R)-REL- (9CI)
CAS:325961-71-5
Formula: C12H22O3
CB333987
CYCLOPROPANOL, 1-ETHOXY-2-PENTYL-, ACETATE, (1S,2S)- (9CI)
CAS:325961-75-9
Formula: C12H22O3
CB333988
CYCLOPROPANOL, 1-METHOXY-2,3-BIS(1-METHYLETHYL)- (9CI)
CAS:135307-42-5
Formula: C10H20O2
CB275271
CYCLOPROPANOL, 2,2-DICHLORO-, FORMATE (9CI)
CAS:447426-62-2
Formula: C4H4Cl2O2
CB349528
CYCLOPROPANOL, 2-(DIMETHYLAMINO)-, ACETATE (ESTER), (1R,2R)-REL- (9CI)
CAS:387844-99-7
Formula: C7H13NO2
CB339207
CYCLOPROPANOL, 2-(DIMETHYLAMINO)-, ACETATE (ESTER), (1R,2S)-REL- (9CI)
CAS:387844-98-6
Formula: C7H13NO2
CB339206
CYCLOPROPANOL, 2-[(DIMETHYLAMINO)METHYL]-, ACETATE (ESTER), (1R,2S)-REL- (9CI)
CAS:387845-04-7
Formula: C8H15NO2
CB339208
CYCLOPROPANOL, 2-ETHOXY-1-ETHYNYL-, METHANESULFONATE, (1R-CIS)- (9CI)
CAS:178899-54-2
Formula: C8H12O4S
CB295344
CYCLOPROPANOL, 2-ETHOXY-1-ETHYNYL-, METHANESULFONATE, (1S-TRANS)- (9CI)
CAS:178751-91-2
Formula: C8H12O4S
CB295308
CYCLOPROPANOL, 2-ETHYL-1-(1E)-1-PROPENYL-, METHANESULFONATE, (1R,2S)-REL- (9CI)
CAS:478945-16-3
Formula: C9H16O3S
CB351866
CYCLOPROPANOL, 2-METHYL-1-(2-PYRIDINYL)-, CIS- (9CI)
CAS:138835-96-8
Formula: C9H11NO
CB277356
CYCLOPROPANOL, 2-METHYL-1-(2-PYRIDINYL)-, TRANS- (9CI)
CAS:138835-97-9
Formula: C9H11NO
CB277357
CYCLOPROPANOL, 2-METHYL-1-(4-PYRIMIDINYL)- (9CI)
CAS:53342-31-7
Formula: C8H10N2O
CB359650
CYCLOPROPANOL;CYCLOPROPYL ALCOHOL; HYDROXYCYCLOPROPANE
CAS:16545-68-9
Formula: C3H6O
CB50232
CYCLOPROPANONE
CAS:5009-27-8
Formula: C3H4O
CB128602
CYCLOPROPENE
CAS:16165-40-5
Formula: C3H4
CB48663
CYCLOPROPENE, (2,3-DIFLUORO-2-CYCLOPROPEN-1-YLIDENE)DIFLUORO- (9CI)
CAS:113613-83-5
Formula: C6F4
CB261607
CYCLOPROPENE, 1,2-DICHLORO-3-(1-METHYLETHYL)- (9CI)
CAS:144897-40-5
Formula: C6H8Cl2
CB280270
CYCLOPROPENE, 1,2-DICHLORO-3-(FLUOROMETHYL)-3-METHYL- (9CI)
CAS:144897-42-7
Formula: C5H5Cl2F
CB280272
CYCLOPROPENE, 1,2-DICHLORO-3-ETHYL-3-METHYL- (9CI)
CAS:144897-41-6
Formula: C6H8Cl2
CB280271
CYCLOPROPENE, 1-BROMO-2,3,3-TRIMETHYL- (9CI)
CAS:108176-09-6
Formula: C6H9Br
CB258165
CYCLOPROPENE, 1-BROMO-2-(1-METHYLETHYL)- (9CI)
CAS:153618-63-4
Formula: C6H9Br
CB286493
CYCLOPROPENE, 1-BROMO-2-ETHYL- (9CI)
CAS:157978-66-0
Formula: C5H7Br
CB288605
CYCLOPROPENE, 1-BROMO-3,3-DIMETHYL- (9CI)
CAS:108176-10-9
Formula: C5H7Br
CB258166
CYCLOPROPENE, 3,3-(1,2-ETHYNEDIYL)BIS[3-METHYL- (9CI)
CAS:125510-65-8
Formula: C10H10
CB269332
CYCLOPROPENE, 3,3-(1,3-BUTADIYNE-1,4-DIYL)BIS- (9CI)
CAS:169271-22-1
Formula: C10H6
CB291957
CYCLOPROPENE, 3,3-DIFLUORO-1,2-DIPROPYL- (9CI)
CAS:138101-04-9
Formula: C9H14F2
CB276905
CYCLOPROPENE, 3,3-DIFLUORO-1-HEXYL- (9CI)
CAS:138101-01-6
Formula: C9H14F2
CB276904
CYCLOPROPENE, 3-(3,3-DIMETHYL-1-BUTYNYL)-3-METHYL- (9CI)
CAS:125510-63-6
Formula: C10H14
CB269331
CYCLOPROPENE, 3-METHYL-3-[(2-METHYLCYCLOPROPYL)ETHYNYL]- (9CI)
CAS:137073-18-8
Formula: C10H12
CB276376
CYCLOPROPENYL RADICAL
CAS:28933-84-8
Formula: C3H3
CB88218
CYCLOPROPENYLIDENE
CAS:16165-40-5
Formula: C3H2
CB246752
CYCLOPROPYL 1H-PYRROL-2-YL KETONE
CAS:30625-80-0
Formula: #
CB327575
CYCLOPROPYL 1H-PYRROL-2-YL KETONE (2,4-DINITROPHENYL)HYDRAZONE
CAS:30625-81-1
Formula: #
CB327576
CYCLOPROPYL 2,4-DICHLOROPHENYL KETONE
CAS:212139-17-8
Formula: C10H8Cl2O
CB316790
CYCLOPROPYL 2-(3-METHOXYPHENYL)ETHYL KETONE
CAS:344334-33-4
Formula: C13H16O2
CB336010
CYCLOPROPYL 2-FLUOROBENZYL KETONE
CAS:150322-73-9
Formula: C11H11FO
CB42529
CYCLOPROPYL 2-METHOXYPHENYL KETONE
CAS:400614-05-3
Formula: C11H12O2
CB345880
CYCLOPROPYL 2-METHYLPHENYL KETONE
CAS:39615-34-4
Formula: C11H12O
CB331934
CYCLOPROPYL 2-PHENETHYL KETONE
CAS:136120-65-5
Formula: C12H14O
CB275745
CYCLOPROPYL 2-PYRIDYL KETONE
CAS:57276-28-5
Formula: C9H9NO
CB367626
CYCLOPROPYL 2-THIENYL KETONE;CYCLOPROPYL(2-THIENYL)METHANONE
CAS:6193-47-1
Formula: C8H8OS
CB159787
CYCLOPROPYL 3,4-DICHLOROPHENYL KETONE
CAS:136906-33-7
Formula: C10H8Cl2O
CB276266
CYCLOPROPYL 3,5-DIMETHYLPHENYL KETONE
CAS:150668-38-5
Formula: C12H14O
CB283705
CYCLOPROPYL 3-METHOXYPHENYL KETONE
CAS:104271-41-2
Formula: C11H12O2
CB255679
CYCLOPROPYL 3-METHYLPHENYL KETONE
CAS:150668-37-4
Formula: C11H12O
CB283704
CYCLOPROPYL 3-THIENYL KETONE
CAS:113348-25-7
Formula: C8H8OS
CB261432
CYCLOPROPYL 4-ETHOXYPHENYL KETONE
CAS:75343-44-1
CB196299
CYCLOPROPYL 4-ETHYLPHENYL KETONE
CAS:50664-71-6
Formula: C12H14O
CB129951
CYCLOPROPYL 4-FLUOROPHENYL KETONE
CAS:772-31-6
Formula: C10H9FO
CB200161
CYCLOPROPYL 4-METHOXYDIPHENYLCARBINOL
CAS:62587-03-5
Formula: C17H18O2
CB161388
CYCLOPROPYL ACETYLENE;CYCLOPROPYLACETYLENE
CAS:6746-94-7
Formula: C5H6
CB174935
CYCLOPROPYL ALLYL KETONE
CAS:62316-07-8
Formula: C7H10O
CB160678
CYCLOPROPYL BROMIDE;BROMOCYCLOPROPANE
CAS:4333-56-6
Formula: C3H5Br
CB121878
CYCLOPROPYL CARBINOL;CYCLOPROPANEMETHANOL; (HYDROXYMETHYL)CYCLOPROPANE; CPMO
CAS:2516-33-8
Formula: C4H8O
CB78917
CYCLOPROPYL CHLOROFORMATE;CARBONOCHLORIDIC ACID CYCLOPROPYL ESTER
CAS:52107-21-8
Formula: C4H5ClO2
CB133933
CYCLOPROPYL DIPHENYL CARBINOL
CAS:5785-66-0
Formula: C16H16O
CB149594
CYCLOPROPYL IODIDE
CAS:19451-11-7
Formula: #
CB251612
CYCLOPROPYL ISOCYANATE;ISOCYANATOCYCLOPROPANE
CAS:4747-72-2
Formula: C4H5NO
CB125776
CYCLOPROPYL ISOCYANIDE;CYCLOPROPANE ISOCARBONITRILE
CAS:58644-53-4
Formula: C4H6N
CB151422
CYCLOPROPYL ISOTHIOCYANATE
CAS:56601-42-4
Formula: C4H5NS
CB146424
CYCLOPROPYL METHOXYLAMINE
CAS:75647-90-4
Formula: C4H9NO
CB196903
CYCLOPROPYL METHYL ETHER
CAS:540-47-6
Formula: C4H8O
CB139263
CYCLOPROPYL METHYL KETONE;1-CYCLOPROPYL-ETHANONE
CAS:765-43-5
Formula: C5H8O
CB198738
CYCLOPROPYL PHENYL KETONE
CAS:2/5/81
Formula: C10H10O
CB326078
CYCLOPROPYL PHENYL SULFIDE
CAS:14633-54-6
Formula: C9H10S
CB40045
CYCLOPROPYL PROPYL KETONE
CAS:6705-46-0
Formula: C7H12O
CB173963
CYCLOPROPYL RADICAL
CAS:2417-82-5
Formula: C3H5
CB300615
CYCLOPROPYL(3-PYRIDYL) KETONE
CAS:24966-13-0
Formula: #
CB308195
CYCLOPROPYL(4-(3-(1H-IMIDAZOL-5-YL)PROPOXY)PHENYL)METHANONE HYDROCHLORIDE
CAS:1049741-81-2
Formula: C16H18N2O2.HCl
CB6746
CYCLOPROPYL(4-FLUOROBENZYL)AMINE;N-CYCLOPROPYL-4-FLUOROBENZYLAMINE
CAS:625437-46-9
Formula: C10H12FN
CB161265
CYCLOPROPYL(4-METHYLPHENYL)-METHANONE
CAS:7143-76-2
Formula: C11H12O
CB186315
CYCLOPROPYL(4-PYRIDYL) KETONE
CAS:39512-48-6
Formula: #
CB331854
CYCLOPROPYL(PYRIDIN-2-YL)METHANAMINE HYDROCHLORIDE;ALPHA-CYCLOPROPYL-2-PYRIDINEMETHANAMINE HYDROCHLORIDE
CAS:478263-93-3
Formula: C9H12N2.HCl
CB126158
CYCLOPROPYL-(2,4-DIMETHYLPHENYL)METHANONE
CAS:71172-79-7
Formula: C12H14O
CB185726
CYCLOPROPYL-(2,5-DIMETHYLPHENYL)METHANOL
CAS:78987-81-2
Formula: C12H16O
CB203530
CYCLOPROPYL-(2,5-DIMETHYLPHENYL)METHANONE
CAS:71172-44-6
Formula: C12H14O
CB185710
CYCLOPROPYL-(2-METHYL-4-PYRIDINYL)-METHANONE
CAS:155047-87-3
Formula: #
CB287146
CYCLOPROPYL-(3,4-DIMETHYLPHENYL)METHANONE
CAS:38675-78-4
Formula: C12H14O
CB112515
CYCLOPROPYL-(3-IODO-PYRIDIN-2-YL)-AMINE
CAS:214074-22-3
Formula: C8H9IN2
CB317178
CYCLOPROPYL-(3-NITROPHENYL)METHANONE
CAS:5680-51-3
Formula: C10H9NO3
CB146905
CYCLOPROPYL-(4-PHENYLPIPERAZIN-1-YL)METHANONE HYDROCHLORIDE
CAS:37012-00-3
Formula: C14H19ClN2O
CB108550
CYCLOPROPYL-(4-PROPAN-2-YLPHENYL)METHANOL
CAS:75024-29-2
Formula: C13H18O
CB195732
CYCLOPROPYL-(5,8,8-TRIMETHYL-9-OXA-3-AZABICYCLO[3.2.2]NONAN-3-YL)METHANONE
CAS:74291-64-8
Formula: C14H23NO2
CB194043
CYCLOPROPYL-DIETHOXYPHOSPHORYLMETHANONE
CAS:1489-91-4
Formula: C8H15O4P
CB41683
CYCLOPROPYLACETIC ACID
CAS:5239-82-7
Formula: C5H8O2
CB134699
CYCLOPROPYLACETONITRILE
CAS:6542-60-5
Formula: C5H7N
CB170410
CYCLOPROPYLAMINE;AMINOCYCLOPROPANE
CAS:765-30-0
Formula: C3H7N
CB198707
CYCLOPROPYLBENZENE;PHENYLCYCLOPROPANE
CAS:873-49-4
Formula: C9H10
CB219514
CYCLOPROPYLBORONIC ACID
CAS:411235-57-9
Formula: C3H7BO2
CB347048
CYCLOPROPYLBORONIC ACID PINACOL ESTER;2-CYCLOPROPYL-4,4,5,5-TETRAMETHYL-1,3,2-DIOXABOROLANE
CAS:126689-01-8
Formula: C9H17BO2
CB24354
CYCLOPROPYLCYCLOHEXANE
CAS:32669-86-6
Formula: C9H16
CB97160
CYCLOPROPYLCYCLOPROPANE
CAS:5685-46-1
Formula: C6H10
CB147002
CYCLOPROPYLDIPHENYLSULFONIUM TETRAFLUOROBORATE;CYCLOPROPYLDIPHENYLSULFONIUM FLUOBORATE
CAS:33462-81-6
Formula: C15H15S.BF4
CB99317
CYCLOPROPYLIDENECYCLOBUTANE
CAS:16764-72-0
Formula: C7H10
CB51157
CYCLOPROPYLIDENECYCLOPROPANE;1,1'-BICYCLOPROPYLIDENE
CAS:27567-82-4
Formula: C6H8
CB84942
CYCLOPROPYLIDENETRIPHENYLPHOSPHORANE
CAS:14633-95-5
Formula: C21H19P
CB244755
CYCLOPROPYLLITHIUM
CAS:3002-94-6
Formula: #
CB325136
CYCLOPROPYLMAGNESIUM BROMIDE
CAS:23719-80-4
Formula: C3H5BrMg
CB75373
CYCLOPROPYLMETHANESULFONYL CHLORIDE
CAS:114132-26-2
Formula: C4H7ClO2S
CB261965
CYCLOPROPYLMETHOXYLAMINE HYDROCHLORIDE;CYCLOPROPYLMETHOXYAMINE HYDROCHLORIDE; O-(CYCLOPROPYLMETHYL)HYDROXYLAMINE HYDROCHLORIDE
CAS:74124-04-2
Formula: C4H9NO.HCl
CB193630
CYCLOPROPYLMETHYL 2-CHLORO-4-(TRIFLUOROMETHYL)PYRIMIDINE-5-CARBOXYLATE
CAS:175137-31-2
Formula: C10H8ClF3N2O2
CB293967
CYCLOPROPYLMETHYL BETA-D-GLUCOPYRANOSIDE
CAS:284039-66-3
Formula: C10H18O6
CB86736
CYCLOPROPYLMETHYL ISOTHIOCYANATE
CAS:6068-90-2
Formula: C5H7NS
CB156708
CYCLOPROPYLMETHYL METHANESULPHONATE
CAS:696-77-5
Formula: C5H10O3S
CB182533
CYCLOPROPYLMETHYL-(3,4-DICHLORO-PHENYL)-AMINE HYDROCHLORIDE
CAS:36178-61-7
Formula: C10H12Cl3N
CB106601
CYCLOPROPYLMETHYL-(4-METHOXY-PHENYL)-AMINE HYDROCHLORIDE
CAS:39959-32-5
Formula: C11H15NO
CB115235
CYCLOPROPYLMETHYL-TRIPHENYLPHOSPHANIUM BROMIDE
CAS:14799-82-7
Formula: C22H22BrP
CB41121
CYCLOPROPYLMETHYLBENZENE
CAS:1667-00-1
Formula: C10H12
CB50707
CYCLOPROPYLTRIMETHYLSTANNANE
CAS:17582-54-6
Formula: #
CB248912
CYCLOPROPYLTRIPHENYLPHOSPHONIUM BROMIDE
CAS:14114-05-7
Formula: C21H20P.Br
CB36117
CYCLOPROPYLZINC BROMIDE SOLUTION 0.5M I&
CAS:126403-68-7
Formula: C3H5BrZn
CB269871
CYCLOPROTOBUXINE C
CAS:1936-70-5
Formula: C27H48N2
CB238874
CYCLOPROVERA
CAS:71615-27-5
Formula: C50H70O7
CB186881
CYCLOSILOXANES, DI-ME, ME PH
CAS:308064-18-8
Formula: #
CB332907
CYCLOSILOXANES, ME 3-(OXIRANYLMETHOXY)PROPYL
CAS:257284-60-9
Formula: #
CB322102
CYCLOSINEFUNGIN
CAS:67214-43-1
Formula: C15H21N7O4
CB174248
CYCLOSPORIN A ANALOG B-5-49
CAS:102819-70-5
Formula: #
CB254483
CYCLOSPORIN A, 1-((3S-(3ALPHA,6BETA,8AALPHA))-HEXAHYDRO-5-OXO-6-AMINO-5H-THIAZOLO(3,2-A)PYRIDINE-3-CARBOXYLIC ACID)-2-DE-D-ALANINE
CAS:153475-57-1
Formula: C64H111N11O12S
CB44395
CYCLOSPORIN A;ANTIBIOTIC S 7481F1; CYCLOSPORINE
CAS:59865-13-3
Formula: C62H111N11O12
CB154372
CYCLOSPORIN B;CYCLO(L-ALANYL-D-ALANYL-N-METHYL-L-LEUCYL-N-METHYL-L-LEUCYL-N-METHYL-L-VALYL-3-HYDROXY-N,4-DIMETHYL-L-2-AMINO-6-OCTENOYL-L-ALANYL-N-METHYLGLYCYL-N-METHYL-L-LEUCYL-L-VALYL-N-METHYL-L-LEUCYL)
CAS:63775-95-1
Formula: C61H109N11O12
CB165597
CYCLOSPORIN C;CYCLO(L-ALANYL-D-ALANYL-N-METHYL-L-LEUCYL-N-METHYL-L-LEUCYL-N-METHYL-L-VALYL-3-HYDROXY-N,4-DIMETHYL-L-2-AMINO-6-OCTENOYL-L-THREONYL-N-METHYLGLYCYL-N-METHYL-L-LEUCYL-L-VALYL-N-METHYL-L-LEUCYL)
CAS:59787-61-0
Formula: C62H111N11O13
CB154184
CYCLOSPORIN D;CYCLO(L-ALANYL-D-ALANYL-N-METHYL-L-LEUCYL-N-METHYL-L-LEUCYL-N-METHYL-L-VALYL-3-HYDROXY-N,4-DIMETHYL-L-2-AMINO-6-OCTENOYL-L-VALYL-N-METHYLGLYCYL-N-METHYL-L-LEUCYL-L-VALYL-N-METHYL-L-LEUCYL)
CAS:63775-96-2
Formula: C63H113N11O12
CB165598
CYCLOSPORIN H;CYCLO(L-ALANYL-D-ALANYL-N-METHYL-L-LEUCYL-N-METHYL-L-LEUCYL-N-METHYL-D-VALYL-3-HYDROXY-N,4-DIMETHYL-L-2-AMINO-6-OCTENOYL-L-2-AMINOBUTANOYL-N-METHYLGLYCYL-N-METHYL-L-LEUCYL-L-VALYL-N-METHYL-L-LEUCYL)
CAS:83602-39-5
Formula: C62H111N11O12
CB211009
CYCLOSPORIN J
CAS:121604-28-2
Formula: #
CB266675
CYCLOSPORINE
CAS:79217-60-0
Formula: C62H111N11O12
CB203883
CYCLOSPORINE METABOLITE M17
CAS:89270-28-0
CB222113
CYCLOSULFAMURON;1-(2-(CYCLOPROPYLCARBONYL)PHENYLSULFAMOYL)-3-(4,6-DIMETHOXYPYRIMIDIN-2-YL)UREA
CAS:136849-15-5
Formula: C17H19N5O6S
CB33002
CYCLOTEN BUTYRATE;BUTANOIC ACID 2-METHYL-5-OXO-1-CYCLOPENTEN-1-YL ESTER
CAS:68227-51-0
Formula: C10H14O3
CB177994
CYCLOTERIAM
CAS:61356-20-5
Formula: C26H27ClN10O4S2
CB158206
CYCLOTERIC MV-SF
CAS:86438-35-9
CB218263
CYCLOTETRACOSANE
CAS:297-03-0
Formula: #
CB299513
CYCLOTETRACOSANE-1,3,5,7,9,11,13,15,17,19,21,23-DODECENE
CAS:3429-25-2
Formula: #
CB325975
CYCLOTETRADECA-1,8-DIYNE
CAS:1540-80-3
Formula: C14H20
CB44700
CYCLOTETRADECANE
CAS:295-17-0
Formula: C14H28
CB89571
CYCLOTETRADECANE-1,3,5,7,9,11,13-HEPTENE
CAS:2873-14-5
Formula: #
CB301851
CYCLOTETRADECANOL
CAS:4413-86-9
Formula: #
CB341203
CYCLOTETRADECANONE
CAS:3603-99-4
Formula: C14H26O
CB106247
CYCLOTETRASILOXANE
CAS:61614-55-9
Formula: C10H23O6Si4
CB158869
CYCLOTETRASILOXANE, 2,4-DIETHENYL-2,4,6,6,8,8-HEXAMETHYL-
CAS:17980-61-9
Formula: #
CB249481
CYCLOTHIAZIDE
CAS:2259-96-3
Formula: C14H16ClN3O4S2
CB72672
CYCLOTHIAZOMYCIN
CAS:133352-26-8
Formula: #
CB274110
CYCLOTHIZENOVNADIUM DIBROMIDE
CAS:100286-36-0
Formula: #
CB252574
CYCLOTRIACONTANE
CAS:297-35-8
Formula: C30H60
CB89988
CYCLOTRIDECANE
CAS:295-02-3
Formula: C13H26
CB89552
CYCLOTRIDECANOL
CAS:10329-91-6
Formula: #
CB239639
CYCLOTRIDECANONE
CAS:832-10-0
Formula: C13H24O
CB210357
CYCLOTRIMETHYLENEDIMETHYLSILANE
CAS:12/7/95
Formula: C5H12Si
CB300315
CYCLOTRIPHOSPHAZENE-PMMH-192 DENDRIMER
CAS:313691-82-6
CB94231
CYCLOTRIPHOSPHAZENE-PMMH-6 DENDRIMER GENERATION 1.0
CAS:189939-11-5
Formula: C48 H48 Cl12 N15 O6 P9 S6
CB298399
CYCLOUNDECANECARBOXYLIC ACID
CAS:831-67-4
Formula: C12H22O2
CB210296
CYCLOUNDECANOL
CAS:24469-57-6
Formula: #
CB307635
CYCLOUNDECANONE
CAS:878-13-7
Formula: C11H20O
CB220245
CYCLOUNDECANONE OXIME
CAS:3189-61-5
Formula: #
CB325479
CYCLOUNDECYLMETHANOL
CAS:29518-02-3
Formula: C12H24O
CB89572
CYCLOVALONE
CAS:579-23-7
Formula: C22H22O5
CB149743
CYCLOVIRACIN B1
CAS:142382-45-4
Formula: #
CB278892
CYCLOVIROBUXIN D;(3B,5A,16A,20S)-4,4,14-TRIMETHYL-3,20-BIS(METHYLAMINO)-9,19-CYCLOPREGNAN-16-OL
CAS:860-79-7
Formula: C26H46N2O
CB217894
CYCLOXYDIM;FOCUS; FOCUS PLUS; FOCUS ULTRA; LASER; STRATOS; 2-(1-(ETHOXYIMINO)BUTYL)-3-HYDROXY-5-(TETRAHYDRO-2H-THIOPYRAN-3-YL)-2-CYCLOHEXEN-1-ONE
CAS:101205-02-1
Formula: C17H27NO3S
CB1876
CYCLOZIL
CAS:53239-58-0
Formula: #
CB359199
CYCLURON;3-CYCLOOCTYL-1,1-DIMETHYLUREA; 1,1-DIMETHYL-3-CYCLOOCTYLUREA; HS 61; N'-CYCLOOCTYL-N,N-DIMETHYLUREA; OMU
CAS:2163-69-1
Formula: C11H22N2O
CB69840
CYCOLATE;S-ETHYL N-CYCLOHEXYL-N-ETHYLTHIOCARBAMATE
CAS:1134-23-2
Formula: C11H21NOS
CB13569
CYCOTIAMINE
CAS:6092-18-8
Formula: C13H16N4O3S
CB157261
CYCRIMINE
CAS:77-39-4
Formula: C19H29NO
CB200566
CYFLUFENAMID
CAS:180409-60-3
Formula: C20H17F5N2O2
CB295833
CYFLUMETOFEN;ALPHA-CYANO-ALPHA-(4-(1,1-DIMETHYLETHYL)PHENYL)-BETA-OXO-2-(TRIFLUOROMETHYL)BENZENEPROPANOIC ACID 2-METHOXYETHYL ESTER
CAS:400882-07-7
Formula: C24H24F3NO4
CB115566
CYFLUTHRIN;CYANO(4-FLUORO-3-PHENOXYPHENYL)METHYL 3-(2,2-DICHLOROETHENYL)-2,2-DIMETHYLCYCLOPROPANECARBOXYLATE; BAY-FCR 1272; BAYTHROID H; BAY-V1 1704; BETA-CYFLUTHRIN; BULLDOCK; CYFOXYLATE; EULAN SP; FCR 1272; FCR 4545; SOFAC; TEMPO 2
CAS:68359-37-5
Formula: C22H18Cl2FNO3
CB178499
CYHALOFOP-BUTYL;(2R)-2-(4-(4-CYANO-2-FLUOROPHENOXY)PHENOXY)PROPANOIC ACID BUTYL ESTER
CAS:122008-85-9
Formula: C20H20FNO4
CB20628
CYHALOTHRIN;CYANO(3-PHENOXYPHENYL)METHYL 3-(2-CHLORO-3,3,3-TRIFLUORO-1-PROPENYL)-2,2-DIMETHYLCYCLOPROPANECARBOXYLATE; 3-(2-CHLORO-3,3,3-TRIFLUORO-1-PROPENYL)-2,2-DIMETHYLCYCLOPROPANECARBOXYLIC ACID CYANO(3-PHENOXYPHENYL) METHYL ESTER
CAS:68085-85-8
Formula: C23H19ClF3NO3
CB177286
CYHALOTHRIN;CYANO-3-PHENOXYBENZYL (1S+1R)-CIS-3-(Z-2-CHLORO-3,3,3-TRIFLUOROPROP-1-ENYL)-2,2-DIMETHYL CYCLOPROPANECARBOXYLATE; ICON; KARATE C50; LAMBDA CYHALOTHRIN; NINJA 10WP; PP321
CAS:91465-08-6
Formula: C23H19ClF3NO3
CB225194
CYHEXATIN;TRICYCLOHEXYLTIN HYDROXIDE
CAS:13121-70-5
Formula: C18H34OSn
CB27591
CYLINDRIN
CAS:17904-55-1
Formula: C31H52O
CB249348
CYLINDROCARPIDINE
CAS:6858-95-3
Formula: C17H19BrN3OS
CB179503
CYLOPROPYLMETHYL CHLORIDE;(CHLOROMETHYL)CYCLOPROPANE
CAS:5911-08-0
Formula: C4H7Cl
CB152537
CYMAL-3
CAS:181135-58-0
Formula: C21H38O11
CB296039
CYMAL-4
CAS:181135-57-9
Formula: C22H40O11
CB296038
CYMARIN
CAS:508-77-0
Formula: C30H44O9
CB353508
CYMAROL
CAS:465-84-9
Formula: C30H46O9
CB339958
CYMBOPOGON SCHOENANTHUS, EXT.
CAS:89998-16-3
CB222892
CYMBOPOGON WINTERIANUS, EXT.
CAS:91771-61-8
CB225650
CYMIAZOLE;2,4-DIMETHYL-N-(3-METHYL-2(3H)-THIAZOLYLIDENE)BENZENAMINE; N-(3-METHYL-3H-THIAZOL-2-YLIDENE)-2,5-XYLIDINE
CAS:61676-87-7
Formula: C12H14N2S
CB159011
CYMOXANIL;1-(2-CYANO-2-METHOXYIMINOACETYL)-3-ETHYLUREA; 2-CYANO-N-((ETHYLAMINO)CARBONYL)-2-(METHOXYIMINO)ACETAMIDE
CAS:57966-95-7
Formula: C7H10N4O3
CB149841
CYMPERATOR
CAS:52315-07-8
Formula: C22H19Cl2NO3
CB358382
CYNARIN
CAS:1884-23-7
Formula: C25H24O12
CB238750
CYNARIN;1,3-DICAFFEOYLQUINIC ACID; (1R,3R,4S,5R)-1,3-BIS((3-(3,4-DIHYDROXYPHENYL)PROPENOYL)OXY)-4,5-DIHYDROXYCYCLOHEXANECARBOXYLIC ACID
CAS:30964-13-7
Formula: C25H24O12
CB93345
CYNARIN;1,4-DICAFFEYLQUINIC ACID; 1,4-BIS(((E)-3-(3,4-DIHYDROXYPHENYL)PROP-2-ENOYL)OXY)-3,5-DIHYDROXYCYCLOHEXANE-1-CARBOXYLIC ACID
CAS:1182-34-9
Formula: C25H24O12
CB16704
CYNAROSIDE
CAS:11/5/73
Formula: C21H20O11
CB354711
CYNATRATOSIDE A
CAS:97399-96-7
Formula: C28H40O8
CB233934
CYNR PROTEIN
CAS:147338-82-7
Formula: #
CB281740
CYNRIT BISMUTH-STRONTIUM CALCIUM
CAS:118392-20-4
Formula: #
CB264680
CYPEMYCIN
CAS:154277-21-1
Formula: #
CB286814
CYPERENE
CAS:2387-78-2
Formula: C15H24
CB300535
CYPERENONE
CAS:3466-15-7
Formula: #
CB326046
CYPERMETHRIN, HIGH EFFECT
CAS:86753-92-6
CB218675
CYPEROLONE
CAS:13741-46-3
Formula: C15H24O2
CB243116
CYPERUS ROTUNDUS, EXT.
CAS:85085-54-7
CB215691
CYPHENOTHRIN;ALPHA-CYANO-3-PHENOXYBENZYL 2,2-DIMETHYL-3-(2-METHYLPROP-1-ENYL)CYCLOPROPANECARBOXYLATE
CAS:39515-40-7
Formula: C24H25NO3
CB114273
CYPHOSIL 104
CAS:465527-59-7
Formula: C48H102O2P2
CB350484
CYPLATATE
CAS:80205-24-9
Formula: C12H22N3O8PPt
CB205589
CYPRENORPHINE
CAS:4406-22-8
Formula: C26H33NO4
CB122740
CYPRESS OIL
CAS:8013-86-3
CB205400
CYPRESS, CUPRESSUS SEMPERVIRENS, EXT.
CAS:84696-07-1
CB213988
CYPRIPEDIN
CAS:8031-72-9
Formula: C16H12O5
CB205812
CYPRIPEDIUM CALCEOLUS PUBESCENS, EXT.
CAS:84775-54-2
CB214246
CYPRISATECI
CAS:23059-38-3
Formula: #
CB306001
CYPROCONAZOL
CAS:113096-99-4
Formula: C15H18ClN3O
CB261305
CYPROCONAZOLE;2-(4-CHLOROPHENYL)-3-CYCLOPROPYL-1-(1,2,4-TRIAZOL-1-YL)BUTAN-2-OL
CAS:94361-06-5
Formula: C15H18ClN3O
CB231175
CYPRODIME
CAS:118111-54-9
Formula: C22H29NO3
CB16647
CYPRODIME HBR
CAS:118111-51-6
Formula: C22H29N1O3
CB264532
CYPRODINIL;4-CYCLOPROPYL-6-METHYL-N-PHENYL-2-PYRIMIDINAMINE; 4-CYCLOPROPYL-6-METHYL-N-PHENYLPYRIMIDIN-2-AMINE
CAS:121552-61-2
Formula: C14H15N3
CB20219
CYPROFURAM;VINICUR; N-(3-CHLOROPHENYL)-N-(TETRAHYDRO-2-OXO-3-FURANYL)CYCLOPROPANECARBOXAMIDE
CAS:69581-33-5
Formula: C14H14ClNO3
CB182288
CYPROHEPTADINE
CAS:129-03-3
Formula: C21H21N
CB25732
CYPROHEPTADINE GLUCURONIDE
CAS:66167-97-3
Formula: C27H30NO6
CB171783
CYPROHEPTADINE HYDROCHLORIDE
CAS:969-33-5
Formula: C21H21N.HCl
CB233599
CYPROHEPTADINE HYDROCHLORIDE ;4-(5H-DIBENZO(A,D)CYCLOHEPTEN-5-YLIDENE)-1-METHYLPIPERIDINE
CAS:41354-29-4
Formula: C21H21N.HCl
CB118398
CYPROLIDOL
CAS:4904-00-1
Formula: #
CB342202
CYPROTERONE ACETATE;6-CHLORO-1B,2B-DIHYDRO-17-HYDROXY-3'H-CYCLOPROPA(1,2)PREGNA-1,4,6-TRIENE-3,20-DIONE 17-ACETATE; ANDROCUR
CAS:427-51-0
Formula: C24H29ClO4
CB120875
CYPROTERONE;6-CHLORO-1B,2B-DIHYDRO-17-HYDROXY-3'H-CYCLOPROPA(1,2)PREGNA-1,4,6-TRIENE-3,20-DIONE
CAS:2098-66-0
Formula: C22H27ClO3
CB67886
CYROMAZINE;N-CYCLOPROPYL-1,3,5-TRIAZINE-2,4,6-TRIAMINE; 2-CYCLOPROPYLAMINO-4,6-DIAMINO-S-TRIAZINE; DIAMINO-6-(CYCLOPROPYLAMINO)-S-TRIAZINE; CYCLOPROPYL-1,3,5-TRIAZINE-2,4,6-TRIAMINE; CYCLOPROPYLMELAMINE; LARVADEX; OMS-2014; TRIGARD
CAS:66215-27-8
Formula: C6H10N6
CB171885
CYS(2)-CYSNH2(5)-ENKEPHALIN
CAS:70768-44-4
Formula: C26H32N6O6S2
CB184797
CYS(ACM)(2,7)-ALPHA-CALCITONIN GENE-RELATED PEPTIDE (HUMAN)
CAS:125448-83-1
Formula: #
CB269273
CYS(NPYS)-ANTENNAPEDIA HOMEOBOX (43-58) AMIDE
CAS:220337-24-6
Formula: C112H176N38O22S3
CB318484
CYS-ASN-VAL-VAL-PRO-LEU-TYR(PO3H2)-ASP-&
CAS:166664-90-0
Formula: C64H104N13O22PS
CB291272
CYS-HEAT SHOCK PROTEIN, 25KD,*FRAGMENT 8 1-93 MOUSE
CAS:165245-21-6
Formula: #
CB290890
CYS-SER-ARG-ALA-ARG-LYS-GLN-ALA-ALA-SER- ILE-LYS-VA
CAS:123063-31-0
Formula: C82H149N31O26S
CB267504
CYS-TYR-ILE-GLN-ASN-CYS-PRO-ARG-GLY-NH2 ACETATE SALT
CAS:74927-14-3
CB195490
CYS-TYR-PHE-GLN-ASN-CYS-PRO-ARG
CAS:37552-33-3
Formula: C44H61N13O12S2
CB109888
CYS7
CAS:136684-54-3
Formula: #
CB276046
CYSTAMINE DIHYDROCHLORIDE;BIS-(2-AMINOETHYL)DISULFIDE DIHYDROCHLORIDE; 2,2'-DITHIODI(ETHYLAMMONIUM) DICHLORIDE; 2,2'-DIAMINODIETHYL DISULFIDE DIHYDROCHLORIDE; 2,2'-DITHIOBIS(ETHYLAMINE) DIHYDROCHLORIDE; DECARBOXYCYSTINE DIHYDROCHLORIDE
CAS:56-17-7
Formula: C4H12N2S2.2(HCl)
CB145349
CYSTAMINE SULFATE HYDRATE
CAS:342385-53-9
Formula: C4H16N2O5S3
CB101212
CYSTAMINE SULFATE;2,2'-DITHIOBIS(ETHYLAMMONIUM) SULPHATE
CAS:16214-16-7
Formula: C4H14N2O4S3
CB48909
CYSTARGIN
CAS:105634-05-7
Formula: #
CB256695
CYSTATHIONINE
CAS:535-34-2
Formula: C7H14N2O4S
CB137792
CYSTATIN ALPHA
CAS:107935-53-5
Formula: #
CB258077
CYSTATIN BETA
CAS:132848-18-1
Formula: #
CB273842
CYSTATIN C, N-TERMINAL OCTAPEPTIDE
CAS:132512-75-5
Formula: #
CB273636
CYSTATIN D
CAS:142539-78-4
Formula: #
CB278970
CYSTEAMINE HYDROCHLORIDE, [1,2-14C]
CAS:58246-44-9
Formula: C2H8ClNS
CB368822
CYSTEAMINE HYDROCHLORIDE;2-AMINOETHANETHIOL HYDROCHLORIDE; 2-AMINOETHANE-1-THIOL HYDROCHLORIDE; MERCAPTAMINE HYDROCHLORIDE; 2-MERCAPTOETHYLAMINE HYDROCHLORIDE; MERCAPTOETHYLAMMONIUM CHLORIDE
CAS:156-57-0
Formula: C2H7NS.HCl
CB46080
CYSTEAMINE S-PHOSPHATE SODIUM SALT
CAS:3724-89-8
Formula: C2H7NNaO3PS
CB109087
CYSTEAMINE SULFATE
CAS:126405-52-5
Formula: #
CB269874
CYSTEAMINE SULFATE,98% MINIMUM
CAS:157-09-5
Formula: C2H9NO4S2
CB236366
CYSTEIC ACID
CAS:13100-82-8
Formula: #
CB241912
CYSTEINE
CAS:4371-52-2
Formula: C3H7NO2S
CB122445
CYSTEINE HYDROCHLORIDE HYDRATE (1:1:1)
CAS:116797-51-4
Formula: C3H10ClNO3S
CB15831
CYSTEINE SULFINIC ACID
CAS:2381-08-0
Formula: #
CB300515
CYSTEINE THIOSULFONATE
CAS:16341-08-5
Formula: #
CB247019
CYSTEINE(4-METHOXYTRITYL)-OH
CAS:177582-20-6
Formula: C23H23NO3S
CB294931
CYSTEINE(FM)-OH
CAS:84888-38-0
Formula: C17H18ClNO2S
CB214638
CYSTEINE, 2-METHYL- (8CI,9CI)
CAS:22681-73-8
Formula: C4H9NO2S
CB305607
CYSTEINE, 3-AMINO-, METHYL ESTER (9CI)
CAS:246225-89-8
Formula: C4H10N2O2S
CB321039
CYSTEINE, CARBAMATE (ESTER) (9CI)
CAS:125356-75-4
Formula: C4H8N2O3S
CB269199
CYSTEINE, N-(1-METHYLETHYL)- (9CI)
CAS:403804-42-2
Formula: C6H13NO2S
CB346356
CYSTEINE, N-ACETYL-2-METHYL-
CAS:116894-35-0
Formula: C6H11NO3S
CB263755
CYSTEINE, N-PROPYL- (9CI)
CAS:403804-41-1
Formula: C6H13NO2S
CB346355
CYSTEINE, PROPYL ESTER (9CI)
CAS:125511-28-6
Formula: C6H13NO2S
CB269335
CYSTEINE, S,2-DIMETHYL- (9CI)
CAS:33099-14-8
Formula: C5H11NO2S
CB330076
CYSTEINE, S-ETHYL-2-METHYL- (9CI)
CAS:33099-15-9
Formula: C6H13NO2S
CB330077
CYSTEINE-BETA-NAPHTHYLAMIDE
CAS:65322-97-6
Formula: C13H14N2OS
CB170179
CYSTEINE-GLUTATHIONE DISULFIDE
CAS:13081-14-6
Formula: C13H22N4O8S2
CB27190
CYSTEINE-RICH EXTENSIN-LIKE PROTEIN
CAS:150791-15-4
Formula: #
CB283753
CYSTEINE-RICH INTESTINAL PROTEIN
CAS:102857-11-4
Formula: #
CB254514
CYSTEINE-RICH PROTEIN, MAMMALIAN
CAS:130704-09-5
Formula: #
CB272532
CYSTEINESULFENIC ACID
CAS:5722-80-5
Formula: #
CB355382
CYSTEINYL-GLUTAMYL-ASPARAGINYL-PROLYL-SERINYL-GLUTAMINYL-PHENYLALANYL-TYROSYL-GLUTAMYL-ASPARTYL-LEUCINE
CAS:98813-21-9
Formula: C58H81N13O22S
CB235159
CYSTEINYL-LEUCYL-GLUTAMYL-GLUTAMYL-PROLYL-CYSTEINE CYCLIC DISULFIDE
CAS:72903-48-1
Formula: C27H42N6O11S2
CB189947
CYSTEINYL-LYSYL-ASPARAGINYL-PHENYLALANINE
CAS:91853-93-9
Formula: C22H34N6O6S
CB225758
CYSTEINYLCOBALAMIN
CAS:60659-91-8
Formula: C65H94CoN14O16PS
CB156643
CYSTEINYLCYSTEINE
CAS:18048-87-8
Formula: #
CB249572
CYSTEINYLHOMOCYSTEINE MIXED DISULFIDE
CAS:4985-47-1
Formula: C7H14N2O4S2
CB128303
CYSTEINYLPROLINE
CAS:70873-84-6
Formula: C10H18N2O5S
CB185066
CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR
CAS:126880-72-6
Formula: #
CB270173
CYSTINE
CAS:24645-67-8
Formula: #
CB307893
CYSTINE KETIMINE
CAS:83711-66-4
Formula: C6H7NO4S2
CB211204
CYSTINE-2,2',3,3,3',3'-D6
CAS:352431-53-9
CB104064
CYSTOSPHAEROL
CAS:6901-60-6
Formula: C23H17Cl2NO3
CB180859
CYT 387;CYT 11387; N-(CYANOMETHYL)-4-(2-((4-(4-MORPHOLINYL)PHENYL)AMINO)-4-PYRIMIDINYL)BENZAMIDE
CAS:1056634-68-4
Formula: C23H22N6O2
CB7466
CYT 997;N-ETHYL-N'-(2-METHOXY-4-(5-METHYL-4-(((1S)-1-(3-PYRIDINYL)BUTYL)AMINO)-2-PYRIMIDINYL)PHENYL)UREA
CAS:917111-44-5
Formula: C24H30N6O2
CB225583
CYT-4 PROTEIN
CAS:147015-41-6
Formula: #
CB281456
CYTALLENE
CAS:131489-68-4
Formula: #
CB273000
CYTARABINE HYDROCHLORIDE;1-BETA-D-ARABINOFURANOSYLCYTOSINE HYDROCHLORIDE; CYTOSINE ARABINOSIDE HYDROCHLORIDE
CAS:69-74-9
Formula: C9H13N3O5.HCl
CB182757
CYTARABINE;CYTOSINE ARABINOSIDE; 4-AMINO-1-BETA-D-ARABINOFURANOSYL-2(1H)-PYRIMIDINONE; ARABINOCYTIDINE;
CAS:147-94-4
Formula: C9H13N3O5
CB41093
CYTEMBENA
CAS:16170-75-5
Formula: #
CB246770
CYTHIOATE;O,O-DIMETHYL O-(4-(AMINOSULFONYL)PHENYL)THIOPHOSPHATE
CAS:115-93-5
Formula: C8H12NO5PS2
CB15239
CYTIDIN-5'-PHOSPHORSAEURE HYDRAT 99
CAS:312693-65-5
Formula: C9H14N3O8P
CB333207
CYTIDINE 2'',3''-CYCLIC MONOPHOSPHATE, SODIUM SALT DIHYDRATE
CAS:41161-51-7
CB118001
CYTIDINE 2',3',5'-TRIACETATE HYDROCHLORIDE (1:1)
CAS:63639-21-4
Formula: C15H20ClN3O8
CB165077
CYTIDINE 2',3'-(HYDROGEN PHOSPHATE)
CAS:633-90-9
Formula: C9H13N3NaO7P
CB164279
CYTIDINE 2',3'-CYCLIC MONOPHOSPHATE, BARIUM SALT
CAS:74263-38-0
Formula: C18H22BaN6O14P2
CB193996
CYTIDINE 2',3'-PHOSPHORIC ACID POTASSIUM SALT
CAS:20486-23-1
Formula: #
CB302820
CYTIDINE 2'-MONOPHOSPHATE
CAS:85-94-9
Formula: C9H14N3O8P
CB217743
CYTIDINE 3'-MONOPHOSPHATE
CAS:84-52-6
Formula: C9H12N3O8P
CB213358
CYTIDINE 3':5'-CYCLIC MONOPHOSPHATE
CAS:8/8/16
Formula: C9H12N3O7P
CB326369
CYTIDINE 5'-(HYDROGEN SULFATE)
CAS:13435-43-3
Formula: #
CB242492
CYTIDINE 5'-(TETRAHYDROGEN TRIPHOSPHATE)
CAS:65-47-4
Formula: C9H16N3O14P3
CB170511
CYTIDINE 5'-(TETRAHYDROGEN TRIPHOSPHATE), 2'-DEOXY-, TETRASODIUM SALT
CAS:3770-58-9
Formula: C36H60N12Na4O52P12
CB326718
CYTIDINE 5'-DIPHOSPHATE TRISODIUM SALT
CAS:34393-59-4
Formula: C9H15N3O11P2.3Na
CB101718
CYTIDINE 5'-DIPHOSPHATE, PERIODATEOXIDIZ ED SODIUM
CAS:102601-46-7
Formula: C9H15N3O11P2
CB254279
CYTIDINE 5'-DIPHOSPHOGLUCOSE, DISODIUM SALT
CAS:102601-30-9
Formula: #
CB254273
CYTIDINE 5'-DIPHOSPHOGLYCEROL DISODIUM SALT
CAS:102601-56-9
Formula: C12H19N3O13P2.2Na
CB3817
CYTIDINE 5'-MONOPHOSPHATE
CAS:104086-76-2
Formula: C9H14N3O6P
CB5688
CYTIDINE 5'-MONOPHOSPHATE N-ACETYLNEURAMINIC ACID
CAS:3063-71-6
Formula: C20H31N4O16P
CB92302
CYTIDINE 5'-MONOPHOSPHATE SODIUM SALT
CAS:13718-47-3
Formula: C9H13N3NaO8P
CB243085
CYTIDINE 5'-PHOSPHO-2-METHYLIMIDAZOLIDE
CAS:85179-51-7
Formula: C13H18N5O7P
CB216102
CYTIDINE 5'-TRIPHOSPHATE DISODIUM SALT HYDRATE
CAS:123334-07-6
Formula: C9H16N3O14P3
CB21948
CYTIDINE 5'-TRIPHOSPHATE, PERIODATE OXIDIZED SODIUM SALT
CAS:75567-73-6
Formula: C9H11N3Na3O14P3
CB196702
CYTIDINE CYCLIC 2',3'-(HYDROGEN PHOSPHATE) SODIUM SALT (1:1)
CAS:15718-51-1
Formula: C9H13N3NaO7P
CB46401
CYTIDINE CYCLIC-3',5'-MONOPHOSPHATE SODIUM SALT
CAS:54925-33-6
Formula: C9H12N3O7P
CB142121
CYTIDINE DIPHOSPHATE-DIDECANOIN
CAS:64199-87-7
Formula: C32H57N3O15P2
CB167731
CYTIDINE HEMISULFATE
CAS:6018-48-0
CB155122
CYTIDINE MONOPHOSPHATE DIALDEHYDE
CAS:63589-74-2
Formula: C9H12N3O8P
CB164955
CYTIDINE MONOPHOSPHATE-N-GLYCOLOYLNEURAMINIC ACID
CAS:98300-80-2
Formula: C20H31N4O17P
CB234753
CYTIDINE PERIODATE OXIDIZED
CAS:61074-05-3
Formula: C9H11N3O5
CB157569
CYTIDINE SULFATE
CAS:32747-18-5
Formula: C9H15N3O9S
CB97349
CYTIDINE-2',3'-MONOPHOSPHORIC ACID
CAS:27214-06-8
Formula: C18H28N6O16P2
CB310966
CYTIDINE-2'-13C
CAS:478511-19-2
CB126197
CYTIDINE-2-14C 5'-MONOPHOSPHATE AMMONIUM SALT
CAS:130150-79-7
Formula: C9H20N5O8P
CB272182
CYTIDINE-2-14C 5'-TRIPHOSPHATE AMMONIUM SALT
CAS:134940-99-1
Formula: C9H25N6O14P3
CB275059
CYTIDINE-3'-MONOPHOSPHATE DISODIUM SALT
CAS:81487-29-8
CB207756
CYTIDINE-5',5'-C-D2
CAS:478511-21-6
CB126198
CYTIDINE-5'-DIPHOSPHATE DISODIUM SALT;CDP.NA2
CAS:54394-90-0
Formula: C9H13N3Na2O11P2
CB140393
CYTIDINE-5'-DIPHOSPHO-DIMETHYLAMINOETHANOL SODIUM SALT
CAS:119629-11-7
Formula: C13H22N4Na2O11P2
CB265454
CYTIDINE-5'-O-(1-THIOTRIPHOSPHATE), RP-ISOMER SODIUM SALT
CAS:118353-34-7
Formula: C9H12N3Na4O13P3S
CB264651
CYTIDINE-5'-O-DIMETHYLPHOSPHATE
CAS:94369-26-3
Formula: C11H18N3O8P
CB231183
CYTIDINE-5'-TRIPHOSPHATE DISODIUM SALT DIHYDRATE
CAS:81012-87-5
Formula: C9H14N3Na2O14P3.2(H2O)
CB206998
CYTIDINE-5'-TRIPHOSPHATE DISODIUM SALT;DTTP.NA2
CAS:36051-68-0
Formula: C9H14N3Na2O14P3
CB106275
CYTIDINE-5'-TRIPHOSPHORIC ACID DISODIUM SALT
CAS:18423-42-2
Formula: C9H14N3Na2O14P3
CB58772
CYTIDINE-5-T
CAS:14419-78-4
CB38529
CYTIDINE;4-AMINO-1-BETA-D-RIBOFURANOSYL-2(1H)-PYRIMIDINONE; 1-BETA-RIBOFURANOSYLOSINE
CAS:65-46-3
Formula: C9H13N3O5
CB170492
CYTIDYLIC ACID;5'-CYTIDYLATE MONOPHOSPHATE; CYTIDINE-5'-MONOPHOSPHORIC ACID; CYTIDINE 3'-(DIHYDROGEN PHOSPHATE); CMP
CAS:63-37-6
Formula: C9H14N3O8P
CB164251
CYTIDYLYL(2'5')GUANOSINE AMMONIUM
CAS:102601-47-8
Formula: C19H25N8O12P
CB254280
CYTIDYLYL(3'-5')CYTIDINE AMMONIUM
CAS:27552-98-3
Formula: C18H25N6O12P.H3N
CB311349
CYTIDYLYL(3'-5')GUANOSINE AMMONIUM
CAS:27553-01-1
Formula: C19H25N8O12P
CB311350
CYTIDYLYL-(2'-5')ADENOSINE AMMONIUM
CAS:102616-37-5
Formula: C19H25N8O11P
CB254298
CYTISINE
CAS:15191-27-2
Formula: C11H14N2O
CB43493
CYTISINE;(1R,5S)-1,2,3,4,5,6-HEXAHYDRO-1,5-METHANOPYRIDO(1,2-A)(1,5)DIAZOCIN-8-ONE
CAS:485-35-8
Formula: C11H14N2O
CB126916
CYTOBLASTIN
CAS:137109-42-3
Formula: #
CB276400
CYTOCHALASIN A
CAS:14110-64-6
Formula: C29H35NO5
CB243814
CYTOCHALASIN B;(7S),(20R)-DIHYDROXY-16(R)-METHYL-10-PHENYL-24-OXA(14)CYTOCHALASA-6(12),13(E),21(E)-TRIENE-1,23-DIONE
CAS:14930-96-2
Formula: C29H37NO5
CB41888
CYTOCHALASIN C
CAS:22144-76-9
Formula: C30H37NO6
CB304835
CYTOCHALASIN D
CAS:22144-77-0
Formula: C30H37NO6
CB304836
CYTOCHALASIN E
CAS:36011-19-5
Formula: C28H33NO7
CB106195
CYTOCHALASIN H
CAS:53760-19-3
Formula: C30H39NO5
CB360101
CYTOCHALASIN J
CAS:53760-20-6
Formula: C28H37NO4
CB360102
CYTOCHALASING
CAS:54874-57-6
Formula: #
CB361887
CYTOCHALASINP
CAS:108050-27-7
Formula: #
CB259673
CYTOCHROME B 564
CAS:52296-73-8
Formula: #
CB358366
CYTOCHROME B557
CAS:12705-48-5
CB241550
CYTOCHROME B561
CAS:11130-51-1
Formula: #
CB240332
CYTOCHROME B566
CAS:11130-52-2
Formula: #
CB240333
CYTOCHROME BD-II OXIDASE SUBUNIT I, E COLI
CAS:144997-58-0
Formula: #
CB280340
CYTOCHROME C
CAS:9007-43-6
Formula: C42H54FeN8O6S2
CB223208
CYTOCHROME C FROM BOVINE HEART
CAS:108021-98-3
Formula: #
CB259659
CYTOCHROME C''
CAS:116110-46-4
Formula: #
CB263226
CYTOCHROME C5
CAS:51811-53-1
Formula: #
CB357785
CYTOCHROME C557
CAS:51811-54-2
Formula: #
CB357786
CYTOCHROME P 460
CAS:62395-29-3
CB160853
CYTOCHROME P-450 4D2
CAS:157574-86-2
Formula: #
CB288477
CYTOCHROME P-450 EF
CAS:156320-24-0
Formula: #
CB287939
CYTOCHROME P-452
CAS:12679-56-0
Formula: #
CB241520
CYTODENT
CAS:114691-28-0
Formula: #
CB262296
CYTOHELICASE
CAS:42613-29-6
Formula: C14H23N
CB344588
CYTOKININS
CAS:308064-23-5
Formula: #
CB332908
CYTOLIPIN R
CAS:12244-28-9
Formula: #
CB241178
CYTOMEGALOVIRUS PHOSPHOPROTEIN 71KDA
CAS:107852-97-1
Formula: #
CB258032
CYTOPLASMIC LINKER PROTEIN 170
CAS:148349-95-5
Formula: #
CB282425
CYTOROSEMIN PX
CAS:53239-59-1
CB136831
CYTOSINE ARABINOSIDE 5'-TRIPHOSPHATE, SODIUM SALT
CAS:102601-42-3
Formula: #
CB254277
CYTOSINE BETA-D-ARABINOFURANOSIDE HYDROCHLORIDE
CAS:29363-79-9
Formula: #
CB313341
CYTOSINE HYDROCHLORIDE
CAS:1784-08-3
Formula: C4H6ClN3O
CB238527
CYTOSINE, 1-ETHYL-5,6-DIHYDRO- (8CI)
CAS:28461-58-7
Formula: C6H11N3O
CB312381
CYTOSINE, 5-(AMINOMETHYL)- (6CI)
CAS:120908-32-9
Formula: C5H8N4O
CB266230
CYTOSINE, N-OXIDE (7CI,8CI)
CAS:2048-51-3
Formula: C4H5N3O2
CB299646
CYTOSINE-2-14C
CAS:52659-21-9
CB135318
CYTOSINE-SPECIFIC RIBONUCLEASE
CAS:73508-01-7
CB191415
CYTOSINE;4-AMINO-2(1H)-PYRIMIDINONE; 2-OXY-4-AMINO PYRIMIDINE
CAS:71-30-7
Formula: C4H5N3O
CB185983
CYTOSININE
CAS:1860-84-0
Formula: #
CB238719
CYTOSKELETON PROTEIN, 33 KDA
CAS:147994-08-9
Formula: #
CB282207
CYTOSKELETON-ASSOCIATED P85 PROTEIN
CAS:145110-61-8
Formula: #
CB280410
CYTOSOLIC PHOSPHOPROTEIN P19
CAS:126195-39-9
Formula: #
CB269738
CYTOTOXIC NECROTIZING FACTOR TYPE 1
CAS:106803-33-2
Formula: #
CB257414
CYTOTRIENIN A
CAS:208527-57-5
Formula: #
CB316105
CYTOVARICIN, 12-DE((2,6-DIDEOXY-3-O-METHYL-BETA-D-RIBO-HEXOPYRANOSYL)OXY)-
CAS:119313-46-1
Formula: C40H68O12
CB17888
CYTOXAZONE
CAS:220736-25-4
Formula: #
CB318632
CZC 00008004;N2-(4-(AMINOMETHYL)PHENYL)-5-FLUORO-N4-PHENYL-2,4-PYRIMIDINEDIAMINE
CAS:916603-07-1
Formula: C17H16FN5
CB225485
CZC 24832;5-(2-AMINO-8-FLUORO(1,2,4)TRIAZOLO(1,5-A)PYRIDIN-6-YL)-N-(TERT-BUTYL)-3-PYRIDINESULFONAMIDE
CAS:1159824-67-5
Formula: C15H17FN6O2S
CB15291
CZF1 PROTEIN
CAS:148971-43-1
Formula: #
CB282767
D & C RED #30 ALUMINUM LAKE)
CAS:1342-90-1
Formula: #
CB237513
D -(+)-THREO -BETA-HYDROXYASPARTIC ACID
CAS:16417-36-0
Formula: C4H7NO5
CB247133
D 149;5-((4-(4-(2,2-DIPHENYLETHENYL)PHENYL)-1,2,3,3A,4,8B-HEXAHYDROCYCLOPENT(B)INDOL-7-YL)METHYLENE)-2-(3-ETHYL-4-OXO-2-THIOXO-5-THIAZOLIDINYLIDENE)-4-OXO-3-THIAZOLIDINEACETIC ACID
CAS:786643-20-7
Formula: C42H35N3O4S3
CB203078
D&CORANGENO.16
CAS:31544-98-6
Formula: #
CB328610
D(+)-10-CAMPHORSULFONYL CHLORIDE;D-CAMPHOR-10-SULFONYL-CHLORIDE; (1S)-CAMPHOR-10-SULFONIC ACID CHLORIDE
CAS:21286-54-4
Formula: C10H15ClO3S
CB68793
D(+)-A-HYDRAZINOHISTIDINE HYDROCHLORIDE
CAS:1199-91-3
Formula: C6H12ClN5O2
CB237102
D(+)-ALPHA-DIMETHYLAMINO-EPSILON-CAPRO LACTAM
CAS:88764-67-4
CB221675
D(+)-CARVONE;D-1-METHYL-4-ISOPROPENYL-6-CYCLOHEXEN-2-ONE; D-P-MENTHA-6,8,(9)-DIEN-2-ONE; (S)-(+)-P-MENTHA-6,8-DIEN-2-ONE
CAS:2244-16-8
Formula: C10H14O
CB72331
D(+)-GALACTOSAMINE HYDROCHLORIDE;2-AMINO-2-DEOXY-D-GALACTOSE HYDROCHLORIDE; D-CHONDROSAMINE HYDROCHLORIDE
CAS:1772-03-8
Formula: C6H13NO5.HCl
CB56075
D(+)-GLUCOPYRANOSE 6-PHOSPHATE
CAS:56-73-5
Formula: C6H13O9P
CB146763
D(+)-GLUCOPYRANOSE 6-PHOSPHATE MONOPOTASSIUM SALT
CAS:103192-55-8
Formula: C6H12KO9P
CB254782
D(+)-GLUCOSE-6-((13)C)
CAS:106032-62-6
Formula: C6H12O6
CB256956
D(+)-GLUCOSE;D-GLUCOSE ANHYDROUS; DEXTROSE
CAS:50-99-7
Formula: C6H12O6
CB130833
D(+)-GLUCURONO-3,6-LACTONE;D-GLUCURONE
CAS:32449-92-6
Formula: C6H8O6
CB96659
D(+)-HISTIDINOL DIHYDROCHLORIDE
CAS:75614-84-5
Formula: C6H12N3O
CB196808
D(+)-MALIC ACID;D-HYDROXYSUCCINIC ACID; (R)-HYDROXYBUTANEDIOIC ACID
CAS:636-61-3
Formula: C4H6O5
CB165140
D(+)-PHENYLALANINOL;D-ALPHA-PHENYLALANINOL; D(+)-2-AMINO-3-PHENYL-1-PROPANOL
CAS:5267-64-1
Formula: C9H13NO
CB135408
D(+)-PIPECOLINIC ACID;(R)-(+)-2-PIPERIDINECARBOXYLIC ACID
CAS:1723-00-8
Formula: C6H11NO2
CB53209
D(+)-RAFFINOSE PENTAHYDRATE
CAS:17629-30-0
Formula: C18H32O16.5(H2O)
CB55683
D(+)-RIBONIC ACID GAMMA-LACTONE
CAS:8/3/36
Formula: C5H8O5
CB354649
D(+)-SUCROSE;ALPHA-D-GLUCOPYRANOSYL BETA-D-FRUCTOFURANOSIDE; BETA-D-FRUCTOFURANOSE-(2-1)-ALPHA-D-GLUCOPYRANOSIDE; SUCROSE; SACCHAROSE
CAS:57-50-1
Formula: C12H22O11
CB148693
D(+)-TREHALOSE DIHYDRATE;ALPHA-D-GLUCOPYRANOSYL-ALPHA-D-GLUCOPYRANOSIDE
CAS:6138-23-4
Formula: C12H22O11.2(H2O)
CB158283
D(+)-TRYPTOPHAN;(R)-2-AMINO-3-(3-INDOLYL)PROPIONIC ACID; D-ALPHA-AMINO-3-INDOLEPROPIONIC ACID; 3,3'-INDOLYL-2-ALANINE
CAS:153-94-6
Formula: C11H12N2O2
CB44622
D(+)-XYLOSE;WOOD SUGAR
CAS:58-86-6
Formula: C5H10O5
CB151904
D(+)FRUCTOFURANOSE 1,6-DIPHOSPHATE TETRA(CYCLOHEXYLAMMONIUM) SALT
CAS:103213-44-1
Formula: C6H26N4O12P2
CB254813
D(+)GLYCERIC ACID HEMICALCIUM SALT
CAS:14028-62-7
Formula: C6H10CaO8
CB243648
D(-)-4-CHLOROPHENYLGLYCINE;(R)-AMINO-(4-CHLOROPHENYL)ACETIC ACID
CAS:43189-37-3
Formula: C8H8ClNO2
CB121705
D(-)-4-HYDROXYPHENYLGLYCINE;4-HYDROXY-D-PHENYLGLYCINE; D-2-(4-HYDROXYPHENYL)GLYCINE; D-P-HYDROXYPHENYLGLYCINE; (R)-ALPHA-AMINO-4-HYDROXYBENZENEACETIC ACID
CAS:22818-40-2
Formula: C8H9NO3
CB73180
D(-)-ALLO-THREONINE;(2R,3R)-2-AMINO-3-HYDROXYBUTYRIC ACID
CAS:24830-94-2
Formula: C4H9NO3
CB78042
D(-)-AMETHOPTERIN
CAS:51865-79-3
Formula: C20H22N8O5
CB133283
D(-)-AMETHOPTERIN HYDRATE
CAS:331717-43-2
CB98468
D(-)-ARGININE;D-2-AMINO-5-GUANIDINOVALERIC ACID
CAS:157-06-2
Formula: C6H14N4O2
CB46333
D(-)-ASPARAGINE MONOHYDRATE;D-2-AMINOSUCCINAMIC ACID HYDRATE
CAS:5794-24-1
Formula: C4H8N2O3.H2O
CB149779
D(-)-FRUCTOSE;D-LEVULOSE; FRUIT SUGAR
CAS:57-48-7
Formula: C6H12O6
CB148647
D(-)-GLUTAMIC ACID;D-2-AMINOGLUTARIC ACID; (R)-2-AMINOPENTANEDIOIC ACID
CAS:6893-26-1
Formula: C5H9NO4
CB180501
D(-)-ISOVALINE;(R)-(-)-2-AMINO-2-METHYLBUTANOIC ACID
CAS:3059-97-0
Formula: C5H11NO2
CB92226
D(-)-NORVALINE
CAS:12/9/13
Formula: C5H11NO2
CB299562
D(-)-PHENYLGLYCINAMIDE
CAS:6485-67-2
Formula: C8H10N2O
CB169110
D(-)-SALICIN;2-(HYDROXYMETHYL)PHENYL-BETA-D-GLUCOPYRANOSIDE
CAS:138-52-3
Formula: C13H18O7
CB34279
D(-)-TARTARIC ACID
CAS:526-83-0
Formula: C4H6O6
CB353662
D(-)-TREO-1-(P-NITROPHENYL)-2-AMINO-1,3-PROPANEDIOL
CAS:2792-51-0
Formula: #
CB301645
D(-)3-PHOSPHOGLYCERIC ACID CALCIUM
CAS:108347-88-2
Formula: C6H8Ca3O14P2
CB258337
D(-)3-PHOSPHOGLYCERIC ACID DISODIUM SALT
CAS:80731-10-8
CB206490
D(-)3-PHOSPHOGLYCERIC ACID TRI(CYCLOHEXYLAMMONIUM) SALT
CAS:108321-47-7
Formula: C3H7O7P(C6H13N)3
CB258292
D(-)PROLINOL;(R)-(-)-2-PYRROLIDINEMETHANOL; (R)-(-)-2-HYDROXYMETHYLPYRROLIDINE
CAS:68832-13-3
Formula: C5H11NO
CB180059
D(15)-NOR-5A-PREGNAN-20-ONE
CAS:32318-97-1
Formula: #
CB329201
D(17A)-HOMOPREGN-17-ENE-17A-CARBOXYLIC ACID, 4-ETHYL-16,20-DIHYDROXY-12-((3-HYDROXY-1-OXOPENTYL)OXY)-4,8-DIMETHYL-, GAMMA-LACTONE, (4BETA,5ALPHA,12BETA,16ALPHA,20R)-
CAS:145613-54-3
Formula: C32H50O6
CB39626
D(CGCAAGTTGGC).D(GCCAACTTGCG)
CAS:148375-91-1
Formula: #
CB282445
D(GGTGGCGACGACTCCTGGAGCCCG)
CAS:139528-83-9
Formula: #
CB277751
D(PT)10
CAS:115760-57-1
Formula: #
CB263015
D(TATC)M(5)ACR-D(GATA) COMPLEX
CAS:103304-59-2
Formula: #
CB254885
D,L N,O-DIDESMETHYLVENLAFAXINE
CAS:135308-74-6
Formula: C15H23NO2
CB275273
D,L N-DESMETHYLVENLAFAXINE
CAS:149289-30-5
Formula: C16H25NO2
CB282986
D,L-N,N-DIDESMETHYL-O-DESMETHYL VENLAFAXINE HYDROCHLORIDE
CAS:135308-76-8
Formula: C14H22ClNO2
CB275274
D,L-PHENYLGLYCINE, NA OR K SALT
CAS:34236-97-0
Formula: #
CB331046
D,L-SELENOCYSTEINE
CAS:18312-66-8
Formula: #
CB249991
D,L-THREO-1-PHENYL-2-DECANOYLAMINO-3-MORPHOLINO-1-PROPANOL HCL
CAS:117019-08-6
Formula: C23H39ClN2O3
CB263839
D,L-THREO-1-PHENYL-2-DECANOYLAMINO-3-MORPHOLINO-1-PROPANOL HYDROCHLORIDE
CAS:73257-80-4
Formula: C24H41ClN2O2
CB190820
D,L-TRANS-4-METHYL-5-METHOXY-1-(1-METHOXY-1-ISOPROPYL)CYCLOHEX-3-ENE
CAS:124547-59-7
Formula: #
CB268628
D-(+)-(2-CHLOROPHENYL)GLYCINE
CAS:86169-24-6
Formula: C8H8ClNO2
CB217980
D-(+)-ALPHA-METHYLBENZYLISOCYANIDE
CAS:21872-33-3
Formula: C9H9N
CB304452
D-(+)-CAMPHORIC ACID;(1R,3S)-(+)-CAMPHORIC ACID; (1R,3S)-1,2,2-TRIMETHYL-1,3-CYCLOPENTANEDICARBOXYLIC ACID
CAS:124-83-4
Formula: C10H16O4
CB23000
D-(+)-CELLOBIOSE
CAS:133-99-3
Formula: C12H22O11
CB30390
D-(+)-CELLOBIOSE;4-BETA-D-GLUCOPYRANSOYL-D-GLUCOPYRANOSE
CAS:528-50-7
Formula: C12H22O11
CB135817
D-(+)-CELLOTETRAOSE
CAS:38819-01-1
Formula: C24H42O21
CB112810
D-(+)-CELLOTRIOSE
CAS:33404-34-1
Formula: C18H32O16
CB99188
D-(+)-DIGITOXOSE
CAS:527-52-6
Formula: C6H12O4
CB135581
D-(+)-FUCOSE
CAS:3615-37-0
Formula: C6H12O5
CB106548
D-(+)-GLUCONO-1,5-LACTONE
CAS:4253-68-3
Formula: C6H10O6
CB340811
D-(+)-GLUCOSE MONOHYDRATE;D-(+)-GLUCOPYRANOSE MONOHYDRATE
CAS:14431-43-7
Formula: C6H12O6.H2O
CB38594
D-(+)-MALIC ACID DIETHYL ESTER
CAS:7554-28-1
Formula: C8H14O5
CB196676
D-(+)-MALTOSE MONOHYDRATE
CAS:6363-53-7
Formula: C12H22O11.H2O
CB165068
D-(+)-MANNOSE;D-MANNOSE
CAS:3458-28-4
Formula: C6H12O6
CB102204
D-(+)-MELEZITOSE
CAS:597-12-6
Formula: C18H32O16
CB153975
D-(+)-METHYL-ALPHA-(2-THIENYLETHAMINO)(2-CHLOROPHENYL)ACETATE HYDROCHLORIDE
CAS:141109-19-5
Formula: C15H16ClNO2S.HCl
CB36094
D-(+)-NEOPTERIN;(S-(R*,S*))-2-AMINO-6-(1,2,3-TRIHYDROXYPROPYL)-1H-PTERIDIN-4-ONE
CAS:2009-64-5
Formula: C9H11N5O4
CB64642
D-(+)-NOREPHEDRINE HYDROCHLORIDE;(S-(R*,S*))-ALPHA-(1-AMINOETHYL)BENZYL ALCOHOL HYDROCHLORIDE; (+)-PHENYLPROPANOLAMINE HYDROCHLORIDE; (1S,2R)-2-AMINO-1-PHENYL-1-PROPANOL HYDROCHLORIDE
CAS:40626-29-7
Formula: C9H13NO.HCl
CB116837
D-(+)-NOREPHEDRINE;(1S,2R)-2-AMINO-1-PHENYL-1-PROPANOL
CAS:37577-28-9
Formula: C9H13NO
CB109940
D-(+)-PANTOICACID
CAS:1112-33-0
Formula: #
CB236729
D-(+)-PHENYLLACTIC ACID;(R)-3-PHENYLLACTIC ACID; (R)-2-HYDROXY-3-PHENYLPROPIONIC ACID
CAS:7326-19-4
Formula: C9H10O3
CB190827
D-(+)-RIBONIC ACID-GAMMA-LACTONE
CAS:34371-14-7
Formula: C5H8O5
CB101624
D-(+)-TREHALOSE
CAS:99-20-7
Formula: C12H22O11
CB235447
D-(+)BIOTIN 2-NITROPHENYL ESTER
CAS:131303-71-4
Formula: C16H19N3O5S
CB272879
D-(-)-2-CHLOROPHENYLGLYCINE METHYL ESTER HYDROCHLORIDE
CAS:212838-70-5
Formula: C9H11Cl2NO2
CB68784
D-(-)-3-ACETYLTHIO-2-METHYLPROPIONIC ACID;D-(-)-S-ACETYL-BETA-MERCAPTOISOBUTYRIC ACID
CAS:76497-39-7
Formula: C6H10O3S
CB198630
D-(-)-3-THIENYLGLYCINE;(ALPHAR)-ALPHA-AMINO-3-THIOPHENEACETIC ACID
CAS:1194-86-1
Formula: C6H7NO2S
CB18044
D-(-)-ALPHA-SULFOBENZYLPENICILLINDISODIUM SALT
CAS:36417-90-0
CB107140
D-(-)-ARABINOSE ;BETA-D-(-)-ARABINOSE
CAS:10323-20-3
Formula: C5H10O5
CB4588
D-(-)-ARGININE HYDROCHLORIDE
CAS:627-75-8
Formula: C6H14N4O2.HCl
CB161976
D-(-)-ASPARAGINE MONOHYDRATE;(R)-2-AMINOSUCCINAMIC ACID MONOHYDRATE; (R)-2-AMINOSUCCINIC ACID 4-AMIDE MONOHYDRATE; D-ASPARTIC ACID 4-AMIDE MONOHYDRATE
CAS:2058-58-4
Formula: C4H8N2O3.H2O
CB66568
D-(-)-ERYTHROSE
CAS:583-50-6
Formula: C4H8O4
CB150695
D-(-)-GULOSE
CAS:4205-23-6
Formula: C6H12O6
CB119661
D-(-)-PANTOLACTONE;PANTOYL LACTONE; DIHYDRO-3-HYDROXY-4,4-DIMETHYL-2(3H)-FURANONE; ALPHA-HYDROXY-BETA,BETA-DIMETHYL-GAMMA-BUTYROLACTONE
CAS:599-04-2
Formula: C6H10O3
CB154479
D-(-)-PENICILLAMINE;3,3-DIMETHYL-D(-)-CYSTEINE
CAS:52-67-5
Formula: C5H11NO2S
CB135406
D-(-)-PRILOCAINE
CAS:14289-32-8
Formula: #
CB244146
D-(-)-THREO-1-4-NITROPHENYL-2-(IODOACETAMIDO)-1, 3-PROPANEDIOL
CAS:40027-73-4
Formula: C11H13IN2O5
CB115406
D-[1,2,3,3'-2H4]GLYCERALDEHYDE
CAS:478529-60-1
Formula: C3H2D4O3
CB351798
D-[1,2,3-13C3]GLYCERALDEHYDE
CAS:478529-54-3
Formula: C3H6O3
CB351795
D-[1,2-13C2]GALACTOSE
CAS:478518-63-7
Formula: C6H12O6
CB351775
D-[1,2-13C2]XYLOSE
CAS:201741-00-6
Formula: C5H10O5
CB314416
D-[1,3-13C2]RIBOSE
CAS:478511-79-4
Formula: C5H10O5
CB351765
D-[1,5-13C2]RIBOSE
CAS:213825-56-0
Formula: C5H10O5
CB317143
D-[1,6-13C2,6,6'-2H2]GLUCOSE
CAS:157171-80-7
Formula: C6H10D2O6
CB288312
D-[1,6-13C2]FRUCTOSE
CAS:287100-71-4
CB87504
D-[1-13C]ERYTHRO-PENT-2-ULOSE
CAS:131771-70-5
Formula: C5H10O5
CB273148
D-[1-13C]THREO-PENT-2-ULOSE
CAS:131771-46-5
Formula: C5H10O5
CB273145
D-[1-14C]GALACTOSE
CAS:5160-32-7
CB132595
D-[1-2H]RIBOSE
CAS:119540-50-0
Formula: C5H9DO5
CB265389
D-[2,5-13C2]RIBOSE
CAS:213825-57-1
Formula: C5H10O5
CB317144
D-[2-13C]ERYTHRO-PENT-2-ULOSE
CAS:131771-71-6
Formula: C5H10O5
CB273149
D-[2-13C]GALACTOSE
CAS:314062-47-0
CB94323
D-[2-13C]GULOSE
CAS:478529-73-6
Formula: C6H12O6
CB351801
D-[2-13C]MANNITOL
CAS:287100-69-0
Formula: C6H14O6
CB324039
D-[2-13C]TAGATOSE
CAS:478506-44-4
Formula: C6H12O6
CB351749
D-[2-13C]THREO-PENT-2-ULOSE
CAS:131771-47-6
Formula: C5H10O5
CB273146
D-[2-13C]THREOSE
CAS:478506-49-9
Formula: C4H8O4
CB351750
D-[2-13C]XYLOSE
CAS:131771-69-2
Formula: C5H10O5
CB273147
D-[2-2H]GLYCERALDEHYDE
CAS:478529-64-5
Formula: C3H5DO3
CB351800
D-[2-2H]RIBOSE
CAS:202480-69-1
Formula: C5H9DO5
CB314609
D-[2-2H]XYLOSE
CAS:288846-91-3
Formula: C5H9DO5
CB324289
D-[3,3'-2H2]GLYCERALDEHYDE
CAS:478529-58-7
Formula: C3H4D2O3
CB351797
D-[3-13C]GALACTOSE
CAS:478518-56-8
Formula: C6H12O6
CB351772
D-[3-13C]GLUCOSE
CAS:287100-64-5
Formula: C6H12O6
CB324038
D-[3-13C]GLYCERALDEHYDE
CAS:478529-50-9
Formula: C3H6O3
CB351792
D-[3-13C]RIBOSE
CAS:211947-12-5
Formula: C5H10O5
CB316760
D-[3-2H]GLUCOSE
CAS:51517-59-0
Formula: C6H11DO6
CB357444
D-[3-2H]RIBOSE
CAS:169783-76-0
Formula: C5H9DO5
CB292207
D-[4,5,6-13C3]GLUCOSE
CAS:478529-47-4
Formula: C6H12O6
CB351791
D-[4,5-13C2]GLUCOSE
CAS:478529-31-6
Formula: C6H12O6
CB351784
D-[4,5-2H2]FRUCTOSE
CAS:478518-48-8
Formula: C6H10D2O6
CB351766
D-[4-13C]GALACTOSE
CAS:478518-58-0
Formula: C6H12O6
CB351773
D-[4-2H]GALACTOSE
CAS:478518-71-7
Formula: C6H11DO6
CB351777
D-[4-2H]GLUCOSE
CAS:56570-89-9
Formula: C6H11DO6
CB366308
D-[4-2H]RIBOSE
CAS:478506-29-5
Formula: C5H9DO5
CB351746
D-[5,6-13C2]GLUCOSE
CAS:478529-46-3
Formula: C6H12O6
CB351790
D-[5-13C]RIBOSE
CAS:139657-62-8
Formula: C5H10O5
CB277851
D-[5-2H]GLUCOSE
CAS:136864-16-9
Formula: C6H11DO6
CB276242
D-[6,6'-2H2]GALACTOSE
CAS:35669-34-2
CB105280
D-[6-13C]FRUCTOSE
CAS:312623-94-2
CB93866
D-[6-13C]GALACTOSE
CAS:478518-62-6
Formula: C6H12O6
CB351774
D-[UL-13C6]FRUCTOSE
CAS:201595-65-5
Formula: C6H12O6
CB314378
D-[UL-13C6]GALACTOSE
CAS:74134-89-7
CB193666
D-[UL-13C6]MANNITOL
CAS:287112-34-9
Formula: C6H14O6
CB324050
D-1,2,3,4-TETRAHYDRO-QUINOLINE-2-CARBOXYLIC ACID HYDROCHLORIDE
CAS:75433-76-0
Formula: C10H12ClNO2
CB196465
D-1,2,3,4-TETRAHYDROISOQUINOLINE-3-CARBOXYLIC ACID HYDROCHLORIDE
CAS:41220-48-8
Formula: C10H11NO2
CB118100
D-1,2,3,4-TETRAHYDROISOQUINOLINE-3-CARBOXYLIC ACID;(R)-1,2,3,4-TETRAHYDRO-3-ISOQUINOLINECARBOXYLIC ACID
CAS:103733-65-9
Formula: C10H11NO2
CB5223
D-1,2,3,4-TETRAHYDRONORHARMAN-3-CARBOXYLIC ACID;(R)-2,3,4,9-TETRAHYDRO-1H-PYRIDO(3,4-B)INDOLE-3-CARBOXYLIC ACID
CAS:72002-54-1
Formula: C12H12N2O2
CB187903
D-1-N-BOC-PROLINAMIDE;TERT-BUTYL (2R)-2-CARBAMOYLPYRROLIDINE-1-CARBOXYLATE
CAS:35150-07-3
Formula: C10H18N2O3
CB103731
D-1-NAPHTHYLALANINE;3-(1-NAPHTHYL)-D-ALANINE
CAS:78306-92-0
Formula: C13H13NO2
CB202593
D-11-AZA-19-NORTESTOSTERONE
CAS:41235-53-4
Formula: C17H25NO2
CB118145
D-1141
CAS:39811-02-4
Formula: #
CB332090
D-2,3-DIAMINOPROPIONIC ACID
CAS:1915-96-4
Formula: C3H8N2O2
CB238823
D-2,4-DIAMINOBUTYRIC ACID
CAS:26908-94-1
Formula: C4H10N2O2
CB310611
D-2,4-DIAMINOBUTYRIC ACID DIHYDROCHLORIDE;(R)-2,4-DIAMINOBUTANOIC ACID DIHYDROCHLORIDE
CAS:127531-11-7
Formula: C4H10N2O2.2(HCl)
CB24880
D-2,4-DICHLOROPHE
CAS:114872-48-9
Formula: C9H9Cl2NO2
CB262434
D-2,4-DICHLOROPHENYLALANINE;2,4-DICHLORO-D-PHENYLALANINE
CAS:114872-98-9
Formula: C9H9Cl2NO2
CB14536
D-2,4-DIMETHYLPHENYLALANINE
CAS:465500-97-4
Formula: C11H15NO2
CB124930
D-2,5-DICHLOROPHENYLALANINE
CAS:718596-54-4
Formula: C9H9Cl2NO2
CB187596
D-2,6-DIFLUOROPHENYL-ALANINE
CAS:266360-62-7
Formula: C9H9F2NO2
CB323174
D-2-(5-BROMOTHIENYL)ALANINE
CAS:264903-54-0
Formula: C7H8BrNO2S
CB323043
D-2-AMINO-3-(5-HYDROXYINDOLYL)PROPIONIC ACID
CAS:7/6/50
Formula: C11H12N2O3
CB340977
D-2-AMINO-3-ETHYLPENTANOIC ACID
CAS:14328-61-1
Formula: C7H15NO2
CB244226
D-2-AMINO-4-BROMO-4-PENTENOIC ACID
CAS:264903-49-3
Formula: C5H8BrNO2
CB323042
D-2-AMINO-4-SULFOBUTYRIC ACID
CAS:56892-03-6
Formula: C4H9NO5S
CB367137
D-2-AMINO-5-PHENYLPENTANOIC ACID
CAS:2046-19-7
Formula: C11H15NO2
CB66062
D-2-AMINO-5-PHENYLPENTANOIC ACID;(R)-2-AMINO-5-PHENYLPENTANOIC ACID
CAS:36061-08-2
Formula: C11H15NO2
CB106306
D-2-AMINOADIPIC ACID;(R)-2-AMINOHEXANEDIOIC ACID; D-HOMOGLUTAMIC ACID
CAS:7620-28-2
Formula: C6H11NO4
CB198013
D-2-AMINOBUTYRIC ACID
CAS:2623-91-8
Formula: C4H9NO2
CB301252
D-2-AMINOBUTYRIC ACID HYDROCHLORIDE;(R)-2-AMINOBUTYRIC ACID HYDROCHLORIDE
CAS:67607-42-5
Formula: C4H9NO2.HCl
CB175218
D-2-AMINODECANOIC ACID
CAS:84276-16-4
Formula: C10H21NO2
CB212732
D-2-AMINOPENTANOIC ACID
CAS:498-18-0
Formula: C5H11NO2
CB128216
D-2-AMINOVALERIC ACID-BENZYL ESTER 4-TOLUENESULFONATE SALT
CAS:218962-76-6
Formula: C19H25NO5S
CB70511
D-2-BOC-7-(FLUORO)-1,2,3,4-TETRAHYDROISOQUINOLINE-3-CARBOXYLIC ACID
CAS:444583-26-0
Formula: C15H18FNO4
CB349239
D-2-BOC-7-(TRIFLUOROMETHYL)-1,2,3,4-TETRAHYDROISOQUINOLINE-3-CARBOXYLIC ACID
CAS:444583-37-3
Formula: C16H18F3NO4
CB349240
D-2-BROMOPHENYLALANINE;(R)-2-AMINO-3-(2'-BROMOPHENYL)PROPANOIC ACID
CAS:267225-27-4
Formula: C9H10BrNO2
CB83002
D-2-CYANOPHENYLALANINE
CAS:263396-41-4
Formula: C10H10N2O2
CB82136
D-2-HYDROXY-3-METHYLVALERIC ACID SODIUM
CAS:103404-55-3
Formula: C6H11NaO3
CB254958
D-2-HYDROXYPENTANEDIOIC ACID DISODIUM SALT;(R)-2-HYDROXYPENTANEDIOIC ACID DISODIUM SALT
CAS:103404-90-6
Formula: C5H6Na2O5
CB4810
D-2-HYDROXYPHENYLALANINE;(R)-2-AMINO-3-(2-HYDROXYPHENYL)PROPANOIC ACID
CAS:24008-77-3
Formula: C9H11NO3
CB76068
D-2-METHYLBUTYL 2-METHYLBUTYRATE;(S-(R*,R*))-2-METHYLBUTANOIC ACID 2-METHYLBUTYL ESTER
CAS:81115-67-5
Formula: C10H20O2
CB207152
D-2-NITROPHENYLALANINE;2-NITRO-D-PHENYLALANINE
CAS:169383-17-9
Formula: C9H10N2O4
CB51912
D-2-PHENYLGLYCINE;D(-)-ALPHA-AMINOPHENYLACETIC ACID; D(-)-ALPHA-PHENYLGLYCINE
CAS:875-74-1
Formula: C8H9NO2
CB219913
D-2-PHOSPHOGLYCERIC ACID BARIUM SALT MONOHYDRATE*
CAS:53823-72-6
Formula: C3H5BaO7P
CB360207
D-2-THIENYLGLYCINE;D-2-(2-THIENYL)GLYCINE; D-ALPHA-AMINO-2-THIOPHENEACETIC ACID
CAS:43189-45-3
Formula: C6H7NO2S
CB121706
D-3,3-DIPHENYLALANINE
CAS:49597-91-1
Formula: #
CB345584
D-3,4-DICHLOROPHENYLALANINE;(R)-2-AMINO-3-(3,4-DICHLOROPHENYL)PROPANOIC ACID
CAS:52794-98-6
Formula: C9H9Cl2NO2
CB135691
D-3,4-DIMETHOXY-PHENYLALANINE
CAS:33605-56-0
CB99716
D-3-(2-FURYL)ALANINE;D-2-FURYLALANINE
CAS:110772-46-8
Formula: C7H9NO3
CB11469
D-3-(2-PYRIDYL)ALANINE METHYL ESTER DIHYDROCHLORIDE;(R)-ALPHA-AMINO-2-PYRIDINEPROPANOIC ACID METHYL ESTER DIHYDROCHLORIDE; D-3-(2-PYRIDYL)ALANINE METHYL ESTER DIHYDROCHLORIDE
CAS:163513-22-2
Formula: C9H12N2O2.2(HCl)
CB49505
D-3-(3-BENZOTHIENYL)ALANINE
CAS:111139-55-0
Formula: C11H11NO2S
CB11789
D-3-(3-THIENYL)ALANINE;3-THIEN-3-YL-D-ALANINE
CAS:152612-26-5
Formula: C7H9NO2S
CB43885
D-3-(CYCLOPROPYL)ALANINE
CAS:121786-39-8
Formula: C6H11NO2
CB20443
D-3-(PENTAFLUOROPHENYL)ALANINE;D-PENTAFLUOROPHE
CAS:40332-58-9
Formula: C9H6F5NO2
CB116199
D-3-ACETAMIDO-3-DEOXY-GLUCOPYRANOSE
CAS:14086-88-5
Formula: C8H15NO6
CB35944
D-3-AMINO-4-(4-FLUOROPHENYL)-BUTYRIC ACID HYDROCHLORIDE
CAS:331763-70-3
Formula: C25H22FNO4
CB98506
D-3-BROMOCAMPHOR-10-SULFONIC ACID MONOHYDRATE;((1S)-ENDO)-(+)-3-BROMO-7,7-DIMETHYL-2-OXO-BICYCLO(2.2.1)HEPTANE-1-METHANESULFONIC ACID MONOHYDRATE; ((1S)-ENDO)-(+)-3-BROMO-10-CAMPHORSULFONIC ACID MONOHYDRATE
CAS:24262-38-2
Formula: C10H15BrO4S.H2O
CB76644
D-3-BROMOCAMPHOR-8-SULFONIC ACID AMMONIUM SALT;((1R)-ENDO,ANTI)-3-BROMO-1,7-DIMETHYL-2-OXO-BICYCLO(2.2.1)HEPTANE-7-METHANESULFONIC ACID AMMONIUM SALT; D(+)-ALPHA-BROMOCAMPHOR-PI-SULFONIC ACID AMMONIUM SALT
CAS:14575-84-9
Formula: C10H18BrNO4S
CB39709
D-3-CHLOROPHENYLALANINE;3-CHLORO-D-PHENYLALANINE; 3-CHLORO-D-PHE-OH; H-D-PHE(3-CL)-OH
CAS:80126-52-9
Formula: C9H10ClNO2
CB205371
D-3-CYANOPHENYLALANINE
CAS:263396-43-6
Formula: C10H10N2O2
CB82138
D-3-PHENYLSERINE MONOHYDRATE;D-3-HYDROXY-2-AMINO-3-PHENYLPROPIONIC ACID MONOHYDRATE
CAS:313222-82-1
Formula: C9H11NO3.H2O
CB94092
D-326II
CAS:50935-05-2
Formula: #
CB356817
D-4,4'-BIPHENYLALANINE;4-PHENYL-D-PHENYALANINE
CAS:170080-13-4
Formula: C15H15NO2
CB52183
D-4-AMINOPHENYLGLYCINE;(R)-2-(4-AMINOPHENYL)GLYCINE
CAS:35619-39-7
Formula: C8H10N2O2
CB105115
D-4-BENZOYLPHENYLALANINE
CAS:201466-03-7
Formula: C16H15NO3
CB64805
D-4-CHLOROPHENYLALANINE;4-CHLORO-D-PHENYLALANINE; 4-CHLORO-3-PHENYL-D-ALANINE
CAS:14091-08-8
Formula: C9H10ClNO2
CB35981
D-4-CHLOROPHENYLGLYCINE HCL
CAS:108392-76-3
Formula: #
CB258374
D-4-CYANOPHENYLALANINE;(2R)-2-AMINO-3-(4-CYANOPHENYL)PROPANOIC ACID
CAS:263396-44-7
Formula: C10H10N2O2
CB82139
D-4-FLUOROPHENYLALANINE HYDROCHLORIDE;4-FLUORO-D-PHENYLALANINE HYDROCHLORIDE; 2-AMINO-3-(4-FLUOROPHENYL)PROPANOIC ACID HYDROCHLORIDE
CAS:122839-52-5
Formula: C9H10FNO2.HCl
CB21563
D-4-FLUOROPHENYLGLYCINE HCL
CAS:144744-41-2
Formula: #
CB280182
D-4-IODOPHENYLGLYCINE
CAS:25673-26-1
Formula: C8H8INO2
CB309099
D-4-ISOPROPYLPHENYLALANINE
CAS:755724-85-7
CB196717
D-4-METHOXYMANDELIC ACID
CAS:20714-89-0
Formula: C9H10O4
CB66991
D-4-PYRIDYLALANINE;(R)-2-AMINO-3-(4-PYRIDYL)PROPIONIC ACID
CAS:37535-50-5
Formula: C8H10N2O2
CB109849
D-4-TETR-BUTYLPHENYLALANINE;4-TERT-BUTYL-D-PHENYLALANINE
CAS:274262-82-7
Formula: C13H19NO2
CB84653
D-43787
CAS:198016-44-3
Formula: C38H44N4O8
CB284990
D-5,5-DIMETHYLTHIAZOLIDINE-4-CARBOXYLIC ACID)
CAS:22916-26-3
Formula: #
CB305863
D-6-OXOPIPECOLINIC ACID;(R)-6-OXOPIPERIDINE-2-CARBOXYLIC ACID
CAS:72002-30-3
Formula: C6H9NO3
CB187900
D-7-HYDROXY-1,2,3,4-TETRAHYDROISOQUINOLINE-3-CARBOXYLIC ACID
CAS:152286-30-1
Formula: C10H11NO3
CB43701
D-9-ANTHRYLAALANINE
CAS:135092-49-8
Formula: C17H15NO2
CB275133
D-A H-PHOSPHONATE)
CAS:104684-74-4
Formula: #
CB256012
D-A-AMINOPHENYLACETIC ACID CHLORIDE
CAS:40647-89-0
Formula: #
CB342869
D-ALA-GLY-PHE-MET-NH2 ACETATE SALT
CAS:100929-65-5
Formula: C21H33N5O6S
CB253056
D-ALA2 D-MET5-ENKEPHALIN ACETATE
CAS:100929-58-6
Formula: C28H37N5O7S1
CB253053
D-ALANINAMIDE
CAS:35320-22-0
Formula: C3H8N2O
CB104382
D-ALANINAMIDE, N-ACETYL-3-(2-NAPHTHALENYL)-D-ALANYL-4-CHLORO-D-PHENYLALANYL-3-(3-PYRIDINYL)-D-ALANYL-L-SERYL-L-TYROSYL-N6-(AMINOCARBONYL)-D-LYSYL-L-LEUCYL-N6-(1-METHYLETHYL)-L-LYSYL-L-PROLYL-
CAS:151272-78-5
Formula: C74H100ClN15O14
CB43101
D-ALANINAMIDE, N-ACETYL-3-(2-NAPHTHALENYL)-D-ALANYL-4-CHLORO-D-PHENYLALANYL-D-TRYPTOPHYL-L-SERYL-L-TYROSYL-N5-(AMINOCARBONYL)-D-ORNITHYL-L-LEUCYL-L-ARGINYL-L-PROLYL-
CAS:120287-84-5
Formula: C73H94ClN17O14
CB18894
D-ALANINAMIDE, N-ACETYL-3-(2-NAPHTHALENYL)-D-ALANYL-4-CHLORO-D-PHENYLALANYL-D-TRYPTOPHYL-L-SERYL-L-TYROSYL-N6-(AMINOCARBONYL)-D-LYSYL-L-LEUCYL-L-ARGINYL-L-PROLYL-
CAS:120287-83-4
Formula: C74H96ClN17O14
CB18893
D-ALANINAMIDE, N-ACETYL-3-(3-QUINOLINYL)-D-ALANYL-4-CHLORO-D-PHENYLALANYL-3-(3-PYRIDINYL)-D-ALANYL-L-ERYL-3-(4-((PYRAZINYLCARBONYL)AMINO)CYCLOHEXYL)-L-ALANYL-N6-(2-PYRIDINYLCARBONYL)-D-LYSYL-L-VALYL-L-ARGINYL-L-PROLYL-, CIS-
CAS:138111-67-8
Formula: C79H102ClN21O14
CB33949
D-ALANINE BENZYL ESTER BENZENESULFONIC ACID SALT
CAS:22839-12-9
Formula: C16H19NO5S
CB305756
D-ALANINE BENZYL ESTER P-TOLUENESULFONATE SALT;L-ALANINE BENZYL ESTER 4-METHYLBENZENESULPHONATE
CAS:41036-32-2
Formula: C17H21NO5S
CB117765
D-ALANINE ETHYL ESTER;(R)-ALANINE ETHYL ESTER; ETHYL D-ALANINATE; O-ETHYL-D-ALANINE
CAS:30959-96-7
Formula: C5H11NO2
CB93340
D-ALANINE TERT-BUTYL ESTER HYDROCHLORIDE;H-D-ALA-OTBU.HCL
CAS:59531-86-1
Formula: C7H15NO2.HCl
CB153543
D-ALANINE, (1R)-1-CARBOXYETHYL ESTER (9CI)
CAS:136577-07-6
Formula: C6H11NO4
CB275984
D-ALANINE, (1S)-1,2-DIMETHYLPROPYL ESTER (9CI)
CAS:402846-72-4
Formula: C8H17NO2
CB346147
D-ALANINE, (R)-CARBOXYHYDROXYMETHYL ESTER (9CI)
CAS:246043-49-2
Formula: C5H9NO5
CB321003
D-ALANINE, [1-14C]
CAS:38062-88-3
CB111098
D-ALANINE, 1-CARBOXYETHYL ESTER, (S)- (9CI)
CAS:56814-77-8
Formula: C6H11NO4
CB367014
D-ALANINE, 1-METHYLPROPYL ESTER (9CI)
CAS:111610-50-5
Formula: C7H15NO2
CB260320
D-ALANINE, 2-HYDROXY-1-(HYDROXYMETHYL)ETHYL ESTER (9CI)
CAS:104537-90-8
Formula: C6H13NO4
CB255879
D-ALANINE, 2-METHYL-3-(METHYLAMINO)- (9CI)
CAS:137394-07-1
Formula: C5H12N2O2
CB276531
D-ALANINE, 3,3,3-TRIFLUORO-2-METHYL- (9CI)
CAS:102210-03-7
Formula: C4H6F3NO2
CB253998
D-ALANINE, 3-(ACETYLAMINO)-, METHYL ESTER (9CI)
CAS:171514-08-2
Formula: C6H12N2O3
CB292751
D-ALANINE, 3-(METHYLSULFINYL)- (9CI)
CAS:23315-24-4
Formula: C4H9NO3S
CB306308
D-ALANINE, 3-[(CARBOXYMETHYL)SULFINYL]-
CAS:125950-10-9
Formula: C5H9NO5S
CB269601
D-ALANINE, 3-[(PHENYLMETHYL)AMINO]-
CAS:119906-14-8
Formula: C10H14N2O2
CB265595
D-ALANINE, 3-[(S)-(PHENYLMETHYL)SULFINYL]-
CAS:394704-97-3
Formula: C10H13NO3S
CB339556
D-ALANINE, 3-[[(1,1-DIMETHYLETHOXY)CARBONYL]AMINO]- (9CI)
CAS:259825-43-9
Formula: C8H16N2O4
CB322456
D-ALANINE, 3-AMINO-2-METHYL- (9CI)
CAS:170384-21-1
Formula: C4H10N2O2
CB292372
D-ALANINE, 3-CYANO-2-METHYL- (9CI)
CAS:202351-51-7
Formula: C5H8N2O2
CB314577
D-ALANINE, N-((5,6,8,13-TETRAHYDRO-1,5,6,7,9,11,14-HEPTAHYDROXY-3-METHYL-8,13-DIOXOBENZO(A)NAPHTHACEN-2-YL)CARBONYL)-
CAS:132971-65-4
Formula: C27H21NO12
CB29389
D-ALANINE, N-(1,2-DIOXOPROPYL)- (9CI)
CAS:188300-91-6
Formula: C6H9NO4
CB297871
D-ALANINE, N-(1-CARBOXYETHYL)-, (R)- (9CI)
CAS:103954-11-6
Formula: C6H11NO4
CB255425
D-ALANINE, N-(1-METHYLETHYL)- (9CI)
CAS:118333-27-0
Formula: C6H13NO2
CB264638
D-ALANINE, N-(1-OXO-2,4-HEXADIENYL)-, (E,E)- (9CI)
CAS:110660-88-3
Formula: C9H13NO3
CB259485
D-ALANINE, N-(1-OXOBUTYL)- (9CI)
CAS:136897-41-1
Formula: C7H13NO3
CB276263
D-ALANINE, N-(2-AMINOETHYL)- (9CI)
CAS:243653-67-0
Formula: C5H12N2O2
CB320720
D-ALANINE, N-(2-METHYL-1-OXOPROPYL)- (9CI)
CAS:130408-42-3
Formula: C7H13NO3
CB272357
D-ALANINE, N-(2-METHYLPROPYL)-, METHYL ESTER (9CI)
CAS:198630-68-1
Formula: C8H17NO2
CB285118
D-ALANINE, N-(AMINOCARBONYL)- (9CI)
CAS:24809-90-3
Formula: C4H8N2O3
CB308065
D-ALANINE, N-(CARBOXYCARBONYL)- (9CI)
CAS:136868-52-5
Formula: C5H7NO5
CB276246
D-ALANINE, N-(ETHOXYCARBONYL)- (9CI)
CAS:148731-47-9
Formula: C6H11NO4
CB282622
D-ALANINE, N-(METHOXYCARBONYL)- (9CI)
CAS:171567-85-4
Formula: C5H9NO4
CB292775
D-ALANINE, N-(METHOXYCARBONYL)-, METHYL ESTER (9CI)
CAS:208453-80-9
Formula: C6H11NO4
CB316060
D-ALANINE, N-(N-(N2,N6-DIACETYL-L-LYSYL)-D-ALANYL)-
CAS:24570-65-8
Formula: #
CB307786
D-ALANINE, N-(N-METHYL-D-ALANYL)- (9CI)
CAS:108814-06-8
Formula: C7H14N2O3
CB258576
D-ALANINE, N-(N-METHYL-L-ALANYL)- (9CI)
CAS:108814-05-7
Formula: C7H14N2O3
CB258575
D-ALANINE, N-[(2-AMINOCYCLOPENTYL)CARBONYL]-, (1R-CIS)- (9CI)
CAS:135097-03-9
Formula: C9H16N2O3
CB275140
D-ALANINE, N-[(2-AMINOCYCLOPENTYL)CARBONYL]-, (1S-CIS)- (9CI)
CAS:135097-04-0
Formula: C9H16N2O3
CB275141
D-ALANINE, N-[(2R)-2-AMINOPROPYL]- (9CI)
CAS:252367-79-6
Formula: C6H14N2O2
CB321611
D-ALANINE, N-[(2S)-2-AMINOPROPYL]- (9CI)
CAS:252367-77-4
Formula: C6H14N2O2
CB321609
D-ALANINE, N-[[5-[[4,6-DIDEOXY-4-(METHYLAMINO)-3-O-.BETA.-D-XYLOPYRANO SYL-.BETA.-D-GALACTOPYRANOSYL]OXY]-5,6,8,13-TETRAHYDRO-1,6,9,14-TETRAH YDROXY-10-IODO-11-METHOXY-3-METHYL-8,13-DIOXOBENZO[A]NAPHTHACEN-2-YL]C ARBONYL]-, (5S-TRANS)- (9CI)
CAS:153619-28-4
Formula: #
CB286494
D-ALANINE, N-[6-[(HYDROXYIMINOMETHYL)AMINO]-1-OXOHEXYL]- (9CI)
CAS:173183-92-1
Formula: C10H19N3O4
CB293268
D-ALANINE, N-1-(TRIFLUOROACETYL)-L-PROLYL-, METHYL ESTER
CAS:3183-70-8
Formula: #
CB325470
D-ALANINE, N-BUTYL- (9CI)
CAS:124151-46-8
Formula: C7H15NO2
CB268405
D-ALANINE, N-D-ALANYL-, LABELED WITH CARBON-14 (9CI)
CAS:110652-05-6
Formula: C6H12N2O3
CB259476
D-ALANINE, N-FORMYL- (6CI,9CI)
CAS:42918-85-4
Formula: C4H7NO3
CB344782
D-ALANINE, N-HYDROXY-, ETHYL ESTER (9CI)
CAS:120049-41-4
Formula: C5H11NO3
CB265679
D-ALANINE, N-L-LYSYL-, LABELED WITH CARBON-14 (9CI)
CAS:128262-80-6
Formula: C9H19N3O3
CB271010
D-ALANINE, N-NITRO- (9CI)
CAS:181182-86-5
Formula: C3H6N2O4
CB296049
D-ALANINE, PROPYL ESTER (9CI)
CAS:104055-32-5
Formula: C6H13NO2
CB255514
D-ALANINE-13C3
CAS:286460-72-8
CB87350
D-ALANINE-2-D1
CAS:56595-54-1
CB146414
D-ALANINE-3,3,3-D3
CAS:177614-69-6
Formula: C3H4D3NO2
CB294944
D-ALANINE-3-13C
CAS:133665-48-2
Formula: C3H7NO2
CB274313
D-ALANINE;D-2-AMINOPROPIONIC ACID; (R)-2-AMINOPROPIONIC ACID
CAS:338-69-2
Formula: C3H7NO2
CB100300
D-ALANYL-D-ALANINE;D-ALA-D-ALA
CAS:923-16-0
Formula: C6H12N2O3
CB226255